4f7a13c4

Writing 'Genealogy Methods and Techniques'

Thu, 26 Mar 2026 12:46:28 GMT

Update: 26 March 2026

After a minor delay caused by a hold up in customs, it's PUBLICATION DAY in the UK at last. Genealogy Methods and Techniques - A Practical Guide to Research is now available to purchase in the UK with varying dates of publication in other countries. Thank you so much to everyone who has preordered this already.

Take a sneak peak with the video below or visit my Books page now for an introduction from me as to what to expect.

Update: 19 Feb 2026

I was delighted to receive my advance copy of my book in the post this week (pictured). I'm so pleased with the printing quality and all those images look great (for book nerds amongst you: it also smells great!).

The date for publication now appears set as 19th March 2026, though shipping times seems to vary depending on where you buy your copy from. As always, the latest information is available here: https://www.crowood.com/book/genealogy-methods-and-techniques

Update: 23 Dec 2025

I have received an early Christmas present today. My publisher, Crowood Press, have released the final version of my book cover and I am now able to share it with you all.

Early indications are that Genealogy Methods and Techniques - A Practical Guide to Research will be published sometime in February or March 2026 . You will see an exact date in late February on some of the book selling sites. This was based on draft estimates before the book was finalised, so it may be a little later than this.

You can find more at Crowood and you can already pre-order my book in print and e-book form on major book selling websites such as Amazon UK (and some other countries), Waterstones, TG Jones and Barnes and Noble.

Update: 23 Jul 2025

I am very excited to announce that the title for my book has now been confirmed as:

Genealogy Methods and Techniques - A Practical Guide to Research

Original blog post: 27 May 2025

I've been a little quiet of late on the blog front, but I have been busily writing elsewhere. I'm in the process of having my very first book published, on gene alogy methods and techniques . This developed as a germ of an idea a long time ago when I began my research. There was lots of information out there on how to use sources, how to get started with your family tree, how to understand the complexities of wills and probate courts and so on, but there was next to nothing on how to research your family tree . A few books have been published over the years but these are mostly in the US, so tend to use US records as the examples.

For as long as I can remember I have always wanted to write a book of some sort and for many years, writing this book became a dream of mine, one of those "I would so love to do that one day" ambitions that you keep in mind you will one day go for but, perhaps, will wait until you "feel more ready" or are brave enough to share your idea with others. As it happened a number of things came together at once and I pulled together my "vague ideas and notions" of what such a book could look like into a reasonable draft structure over a weekend. As soon as I had this part down I knew it was time to go for it, as everything was suddenly more clear.

I didn't want to write a book aimed just for beginners as I strongly believe that we all continue to learn something new, all the time. I was also hearing from students on my Pharos Tutors® methodology courses that they wished they had thought about methodology earlier in their research journey, and these students varied from total beginners to those who had been researching for decades. There are so many fascinating aspects of genealogy research that not every idea made the final cut. Here are some of the ideas that made it into my book. It is written with all levels of genealogist in mind, whether you are building on your research chapter by chapter or going back and looking at how you have done things and seeing whether there are any changes you could make.

I also wanted lots of colour. I wanted to be able to present things in a visual way and I love of bit of colour to understand things more clearly. I wasn't sure I could approach a publisher and make demands on how I wanted things to be (!) but this is where I was so lucky. I made contact with a lovely commissioning editor who works for a non-genealogy publisher. He gave me lots of great advice and suggested I contact the Managing Director at Crowood Press. Mollie loved my idea both about the content for the book and how it could be presented and quickly commissioned me to get started writing a practical guide to research methods. Each chapter ends with suggested next steps for you to take in your own research and try things out.

If you are thinking of writing a book of your own, here is some "don't do what I did" advice. I wasted a lot of time procrastinating before I actually started to get words on paper. There was a lot of research I wanted to do but I ended up in a rabbit hole of "background reading I must do first" and not all of it was even necessary. Several months passed before I even began the writing part and I think that is why I ended up a little too "against the clock" and had to request a small extension on my initial deadline. Obviously I wanted to carry out a lot of research for this book, but it did not all need to be carried out before I had made a start at the writing.

It was only when I took myself away for a couple of weeks of solid writing time that I really got started, and I realised that I had so much to say. In fact, ahem, I had to go back to my publisher to ask for an increase to the contracted word count ��.

My idea all along has been not to create only a "this is how you should do it" book, though I know some readers may be looking for that. I also wanted to use examples and case studies to show you "look how much more you could get from your research if you tried it this way" and "have you ever looked at your research from this perspective?". I am passionate about methods in genealogy and I love to share both research methods, to enable you to be more confident in your family tree, as much as simple colour layouts, like timelines and mind maps, to help to see an overview of your research more clearly.

As this is my first (and possibly only) book there has been a lot to learn along the way. It is not all about writing great content. I wanted to include lots of images and illustrations so have spent a lot of time work ongoing images that are "publication ready". I also wanted to include some document images - after all who wants to read a case study without being able to see what the researcher was looking at? It is amazing how long it can take to get confirmation that the copyright holder is who you think it is and then obtain permissions for publishing of even a single image, and I am thankful to all those who have helped with that along the way.

So, there were some lengthy precesses involved in getting copyright permissions but every one worthwhile to create the book I have always wanted to create. I had some lovely genealogists volunteer to proofread and make comments on my first drafts and I am very grateful for their invaluable input.

I am exceptionally pleased to now announce that my book on genealogy methods and techniques is now in final draft form and has today gone to the publishers! Slightly later than planned but ahead of my deadline extension - can we call that "early"?

Now I have to await feedback and for the publishers to do all the things that publishers do. The current plan is for publication early 2026 .

Sign up below for updates on the publication of my book:

Remembering Mum, Joyce Jenkins (1945-2001)

Wed, 04 Feb 2026 16:24:42 GMT

On the 8th February, 2026 it will be 25 years since my Mum died. In one breath it doesn't seem that long ago, in another it's forever. I thought I would take the time to share some of her story to mark the occasion. Mum was born Joyce Winifred Jenkins on 28th December 1945 in Erdington, which is now part of Birmingham.

At the time of Joyce's birth, her parents, George Hollings and Winifred May (known as Win) Jenkins, were living at 49 New Street, Erdington with Win's widowed mother, Ann Hopkins, and Joyce's older brother, Roger (known as Rog). Joyce wasn't keen on her middle name of Winifred, named after her mother, so when I was born, rather than carry on the family naming tradition, I was given the middle name of Anne, after Joyce's maternal grandmother.

Born just after the end of the Second World War, Mum remembered her parents growing vegetables in the garden and keeping chickens. I always remember her telling me she had a favourite chicken that was all white, and how traumatised she was when it was served up for lunch one day! In an era of seaside holidays being popular, George's uncle, another George Jenkins and his wife, Lilly, took the family on holiday. One trip remembered by Mum's brother was a trip to Bridlington, Yorkshire in 1950 another was to Weston-super-Mare, Somerset. They also used to visit Stratford upon Avon as a family.

By 1950 the family had moved to 195 Moor End Lane where they stayed until both Rog and Mum got married. Mum first attended Moor End Lane Primary and Junior school and then later moved to Erdington Grammar School. I'm yet to hunt for any school records (mental note: must add to "to do" list). Sadly, Mum's parents, George and Win separated in the late 1950s. From what I understand it was a fairly acrimonious split and Mum did not see her Dad for many years. The divorce was finalised in 1965 and both remarried in the couple of years that followed. As a result of Win becoming a single parent, family finances were difficult. Mum therefore had to leave school at 16 years old to get a job. She started at the Inland Revenue and worked her way up to being a “Tax Officer”.

In the early 1960s Mum met my Dad, Brian Young, at a dance in Erdington. They married in 1966 in Castle Bromwich, where Dad was from. As things were difficult between her parents George was not invited to the wedding, though Mum was convinced she spotted him watching from the other side of the road when they came out of the church. Win was a dressmaker and made Mum's wedding dress, Mum's brother, Rog, gave her away. Mum and Dad honeymooned in St Ives, Cornwall but also spent time in Clovelly, Devon where the photo below was taken (and yes, before anyone says it, I am totally against animals being used as photo props, Mum would have been too now).

Mum and Dad lived in Moor End Lane to start with but soon moved to their first home in Burntwood, Staffordshire, with the help of a wedding present of some cash toward the deposit, from Win's second husband, Arthur Hearn. The house in Filton Avenue cost around £3,300 and Dad remembers they bought from plans and couldn't afford the extra £60 for a colour bathroom suite! We still lived there when I was born, but Dad's job as a mechanical engineer meant we moved several times for his work. We lived in Hereford for just over a year and settled in Sutton Coldfield by the late 1970s, where my younger brother was born. When I was born Mum became a "stay at home" Mum.

By the early 1980s my brother had started school and Mum returned to work, first attending night school to get certificates in typing to do "temping" work, and later returning to the Tax Office. In the mid 80s my parents separated, and I know Mum was influenced by her own experiences when she tried to keep everything as normal as possible for us. We even all had Christmas lunch together that first year.

It took a while for Mum to start dating again, but by the late 1990s she had found happiness again with another Brian and he moved into our new home.

Sadly, we lost Mum to ovarian cancer on the 8th February, 2001, three months to the day after she was diagnosed. I was not yet 30, my brother only 21, she has missed so much of our lives. She has a son-in-law, a daughter-in-law, two granddaughters and two step granddaughters, not to mention all the various pets she would have loved to get to know.

Mum loved everything to do with nature, she was the Secretary of the local branch of the World Wildlife Fund for several years. One of the hobbies she shared with my Dad was a love of gardening. We used to go to the local Sutton Park for drives and walks and I can distinctly remember the embarrassment of her being pulled over by the police for "driving too slow" to which her response was "sorry, I was looking for birds". She loved telling stories about family members and the family tree, and it is she who gave me the bug. She was fiercely passionate about supporting her children, and I see that in myself and my brother now.

Thank you for reading her story.

Reflections on 2025

Wed, 31 Dec 2025 19:17:42 GMT

At this time of year I tend to reflect on the year just gone and what is coming up next year. Some of you may have had a rotten 2025 and are looking forward to putting it behind you for a better 2026, others may have exciti ng things planned for 2026 already.

I read in a magazine article recently that highly driven people and perfectionists never give themselves a break. Instead of celebrating success they are always looking for what they could have done better or looking for the next big goal. I certainly recognise myself there, perhaps you do too. The suggestion was that instead of looking ahead and devising an impossibly long "must do" list for 2026, it is wise to take some time to reflect on what has been achieved and what exciting things have happened in 2025.

On a personal level , it was a magnificent year for my daughter. She did really well in her A Level exams and, in September began her university journey studying veterinary medicine. As she is the youngest in our family the house feels very strange now it is just myself and my husband "rattling around", so it has been a period of adjustment for us as well as her.

My husband's health has also much improved. After his kidney transplant in October 2023 he was this year reduced to only needing check ups every six months (*fingers crossed*, *touches wood*, don't want to tempt fate!).

Pharos Tutors® continues to grow and thrive. This year we celebrated additional recognition by AGRA (the Association of Genealogists and Researchers in Archives) for our Advanced Certificate in Genealogy . Our graduates now no longer need to complete the 20 hour research assignment element of application for Member status which, from a time point of view, is a huge part of the application process. This is because AGRA considers our students have already reached the required standard.

In terms of success for me personally the biggest achievement must surely be completing my book, Genealogy Methods and Techniques , and it reaching the printing stage by the end of 2025 (it will be published in early 2026). It has been a lifelong ambition to author a published work and I consider myself very lucky. Not only did the first publisher I contacted "cold" say "yes" straightaway, but they were also happy to listen to my ideas for creating the book I wanted to present to the world. This certainly won't make me rich (I spent a significant proportion of my advance on image licence fees to make sure the finished product was beautifully illustrated) but I consider it my opportunity to contribute more widely to the genealogy community. You can see some of the ideas and included topics in the mind map below.

I also delivered my new Advanced DNA Strategies with Autosomal DNA Pharos Tutors course for the very first time . This had been a long time coming (I think I first started talking about it at RootsTech London back in 2019), but with Covid, making the decision to buy Pharos Tutors, and my husband's health issues there were some very valid reasons for the delay. The first course was fully booked and there are new dates booking up in May and October 2026.

On a more personal level the upcoming 2026 is a big year for me. I share this because I am sure there are other sons and daughters that may have experienced the same feeling after the loss of a parent. In March 2026 I will be 55. Why is that so significant? My Mum died at 55. Don't worry, I haven't gone all hypochondriac on you all, I don't feel as if "my time is up" now, but it has certainly made me reflective. When she died she was obviously very young, although at the time she was "quite old" to me. I have to say though that now I feel like she was "really really young". I read a book recently where the main character was feeling very connected to her mother because she was about to reach the same age as her mother was when she died. I won't go into plot details (involving a breakdown and a prison sentence, neither of which are likely here!) but it said something that really struck a chord: she didn't know what she was supposed to next, after she had reached the age her mother did. That's kind of how I feel. Yes there are lots of people around me who have lived longer, my Dad being one of them, but there is something about reaching the "maximum age" your mother did.

So I am feeling a little like "I don't know what comes next" at the moment. I'm sure finishing my book adds to that, and probably my daughter starting university, and the early months of 2026 will be a time of quiet reflection and gratitude for me.

What I have learned from 2025 is that I really enjoy writing, so that is something I want to continue with (hint, hint, to any commissioning editors out there). I do have an exciting new writing project to work on in the first few months of 2026 (I can't say anymore just yet, but it will be a new way of writing for me so I am very excited).

One of the best parts of teaching for me, and I have seen lots of this in 2025, is helping students find new new things in their own genealogy research, not saying "you must do it this way" but having them try new things for themselves and make their own discoveries. I've had students break down brick walls but also had students realise that an error or two has crept into their research along the way. Seeing students go on to great things is something I always take great pleasure in too, always thinking "I once taught them about x and look at them fly now!"

Whatever the year you've had, I wish you all the very best and hope for good things for you all in 2026.

Happy New Year!

Setting Research Goals

Thu, 02 Jan 2025 11:17:04 GMT

As we start the New Year I am sure some of you are already thinking about what you hope to do with your family history research this year. It's a great time to think about your research goals for the year .

I looked back at my hopes for my own family history in 2024 recently, as recorded in my journal. Whilst my work goals were very clearly defined, for my own research I has simply scribbled:

"work on the Jenkins line 'do-over', start on the Hopkins line"

I have been working through old research again in "recent" years, going back over my very early work from when I knew very little. Unfortunately, as I now know a lot more, there is much more available at my fingertips online than when I started and there is the added complexity of wanting to add more recent relatives for working with DNA matches, what started as a simple idea of a "do-over" has been ongoing since 2012 (hence the "" on recent)!

When I looked back on my notes I instantly felt very discouraged. I had completely underestimated how much work there was to do on the Jenkins line and how little time I would be free to work on my own family history research. As a result, I am still nowhere near completing the Jenkins line work (let alone revisiting my Hopkins ancestors). I had nothing to tick off my list as, as written, it is still ongoing! I mentally slapped my own wrist for writing such an unachievable target. I was always going to "fail" with that as an ambition. We thrive on a sense of achievement and being able to tick things off our "to do" lists (anyone else guilty of adding extra items to their "to do" list just so they can tick them off as complete?). If I had broken my goal down into smaller pieces I would have felt a much greater sense of achievement as the year came to a close.

So that's our first lesson - make sure you set yourself research objectives that are achievable within a reasonable time frame . Think about how much time you will have available to work on your family history per month, and make a realistic estimate of how long you think things could take.

The second point you may have picked up on from my terribly vague Jenkins goal is that it needs to be clear what you mean. Is my do-over just going over old research, adding in more detail as needed and, ahem, improving the source citations (hey, cut me some slack here, this is from when I first started research!)? Or does it include additional research? What additional records do I want to include? In the Jenkins case it is important to be specific so that I am not tempted to go off and research every possible aspect of every single person's life as I go, including researching the occupations they had and the places where they lived. Here I am looking to revise the basis of my family tree, to be happy with what I have to later build upon. So, I might write something like:

Go over existing research on the individuals in the Jenkins line, revisiting the quality of research, notes and source citations and adding more detail and repeating searches where necessary
Add in any census returns and the 1939 register as appropriate, that were not available when the research was first conducted
Add in searches of BMD indexes and parish registers, not readily available online when the research was initially conducted

This way, it is still a lot of work, but I am limiting myself to the basic sources and getting that research to the highest standard. Later I can research interesting individual and places in more detail, or have those as separate research goals for the year, to work on at different times. I also want to bring research forward to more recent times to enable me to identify where my DNA matches fit in more readily. Here I am expanding the scope of my research but again I need to be specific

For research back to 3 x great grandparents, attempt to research the lines forward for each sibling, aiming to get to individuals born around 1920 (after which they will be privatised in online trees anyway)
For research of 4 x great grandparents and beyond, identify BMD events of siblings where possible but don't bring those lines forward yet

So now we have some specifics we need to add in more detail so that will make it easier to see whether I have achieved those objectives. We want to create objectives that are detailed to a level that can be ticked off on a "to do" list - in other words, make them measurable .

In order to do this, I will start with what I have already but add in specific names of individuals:

Go over existing research on the individuals in the Jenkins line, revisiting the quality of research, notes and source citations and adding more detail and repeating searches where necessary
Add in any census returns and the 1939 register as appropriate, that were not available when the research was first conducted
Add in searches of BMD indexes and parish registers, not readily available online when the research was initially conducted
Attempt to research the lines forward for each person, aiming to get to individuals born around 1920
Do all of the above for:
The children of Richard JENKINS (1829-1882) and Mary CHADWICK (1830-1902):

- John JENKINS (1850-1853)

- Jane JENKINS (1853-1931)

- Mary Elizabeth JENKINS (1855-1926)

- Betsy JENKINS (1857-1924)

- Hannah JENKINS (1859-1930)

- Joseph JENKINS (1860-)

- Sarah JENKINS (1862-)

- Edward JENKINS (1864-1864)

- John JENKINS (1865-)

- Robert JENKINS (1867-1868)

- Frederick JENKINS (1869-)

- Louisa JENKINS (1871-1872)

- Ellen JENKINS (1875-)

Thomas JENKINS (1832-1894) and Mary Ellis (b. ?), including first identifying their children

This family had a lot of children at each generation and I write meticulous notes which take a long time, so that could easily take all the time I have available for my own research in 2025. There is a lot I can tick off as I go, giving that sense of achievement, but I can also add in more if I need to.

Now, some of you may have started to notice a theme starting to develop throughout this discussion, particularly if you are used to setting goals for other occupations. In fact everything I have said ties into what is known as creating SMART goals. For your best chance of success your goals for the year should be:

Specific – it is clear what you are looking for

Measurable – it is easy to tell whether or not you have achieved what you set out to and can tick that item off on your “to do” list

Achievable – you have set your objectives within your knowledge of how much time you have available

Realistic – are you setting yourself an impossible dream where records do not exist?

Time-related – here we have been thinking about what to hope to achieve this year

In this post I have concentrated on setting research goals for the year . When you actually get started with your research for a particular month, week or even day, you will be using more detailed research objectives . That's a subject for a later blog post.

Demystifying DNA 5: Uploading Your DNA Data to Other Websites

Sat, 02 Nov 2024 16:21:00 GMT

UPDATED 1st Oct 2025 to reflect the fact that MyHeritage are no longer accepting uploads.

If you are using DNA to problem solve, find a missing ancestor or search for living relatives a piece of advice you will often see is “upload to all the websites to increase your chances of success!”. Sometimes this can seem a little daunting so I have pulled together some step by step instructions on how to download your DNA data from one website and upload it to another.

Max Your Matches

In order to maximise the chance of finding relatives using autosomal DNA data you need to have most matches available. You can achieve this by having your DNA data on as many of the websites as possible.

The main autosomal DNA testing websites are currently Ancestry, MyHeritage, FamilyTreeDNA, Living DNA and 23andMe.

Another website, GEDmatch, does not offer testing but does offer tools and matching. GEDmatch accepts uploads of DNA data from testing carried out at the testing companies.

Downloads and Uploads

The table shows which companies accept uploads of data

A warning before we get started. As soon as you upload your data to another website its use becomes governed by that website's Terms and Conditions and Privacy Policy. Please make sure you are aware of how your data will be used. Some websites (GEDmatch and FamilyTreeDNA, at the time of writing) allow law enforcement agencies to use the DNA matching databases for solving certain types of crime, for example. All of the websites have various opt-in or opt-out options so this is not to put you off - just makes sure you are happy with what you are agreeing to. It should also go without saying that, if you are uploading data on behalf of someone else, it is up to you to get their informed consent.

Back to the process…

Ancestry, MyHeritage and 23andMe do not currently accept uploads of data from other websites. If you are yet to test your best strategy is to test at Ancestry (the largest database by far) and MyHeritage and upload that data to FamilyTreeDNA, Living DNA and GEDmatch. If you have funds to spare, also take the 23andMe test.

The first step is to download your raw DNA data from the company at which you have tested. This is your DNA data itself, not anything to do with match lists. Rather than have pages of instructions here, there are links below to step by step guides for each website:

Once you have your file downloaded you can then upload it elsewhere. Again, rather than have pages of instructions here, there are links below to step by step guides for each website:

All of these instructions are correct at the time of writing. You may find the screens change slightly with time or you have to look in a different part of the screen for the correct place to click, but the principles will remain the same.

Good luck!

[I am not affiliated with any of the DNA testing companies and there are no affiliate links on these blog pages].

How to upload DNA data to GEDmatch

Sat, 02 Nov 2024 15:52:04 GMT

This forms one of a series of guides on how to download DNA data from one website and upload it to another. When I say "DNA data" I mean your raw DNA data file, not a file of your matches, that is something quite different. You may want to download your raw DNA file to make the most of offers from other websites, e.g. My Heritage, to upload the data there for free and get more matches.

Please make sure that YOU are happy with any terms and conditions and privacy policies before proceeding through the various screens.

STEP (1): Go to the GEDmatch website: https://www.gedmatch.com and either "Sign In" or create an acount via the "Join For Free" button.

STEP (2): If you are creating a new account, make sure you read through the Terms and Conditions. Once you have created your account you will need to click on an email verification link to activate the account.

STEP (3): Once your account is activated you will see the GEDmatch homepage. Click on either of the areas circled in red on the image to go to the DNA kit upload area.

STEP (4): Choose your file.

STEP (5): Add information about the person whose kit you are uploading.

STEP (6): Select the appropriate options for the kit origin and your preferred privacy options. Note that GEDmatch does allow the use of its database for law enforcement purposes so select the appropriate option if you do not wish to participate in this. Lastly, click on the upload button at the bottom of the page.

That’s it, all done!

(These instructions and screenshots are current at the time of publishing but the exact layout of the screen and where on the page to click may change with time).

How to download DNA data from and upload to Living DNA

Sat, 02 Nov 2024 15:49:46 GMT

Please make sure that YOU are happy with any terms and conditions and privacy policies before proceeding through the various screens.

There are two parts to this article:

Downloading your data from Living DNA
Uploading a new test to LIving DNA

Downloading your DNA Data from Living DNA

STEP (1): Log in to Living DNA. At the top right hand corner click on the drop down arrow next to your name and click on "Profiles".

STEP (2): At the end of the row for the kit of interest, click on the download icon (circled in red). Note that you can only download data from Living DNA kits (not a kit from elsewhere, that you have uploaded to Living DNA).

STEP (3): Read through the terms of download, click the consent agreement and click the Download autosomal data button.

That’s it, all done! You should now have a .txt file ready to upload to other websites.

Uploading DNA data to Living DNA from elsewhere

Living DNA is one of the websites that accepts uploads from elsewhere. This means you don't have to pay for a Living DNA test to get Living DNA matches. There is a small fee to unlock some of the DNA tools but this is usually cheaper than the cost of a DNA test. Living DNA is the latecomer to the DNA matching party. At the time of writing match numbers are still quite low, but you may still find it useful to upload here if you have a brick wall to solve.

Which tests can be uploaded to Living DNA?

Living DNA accepts uploads from AncestryDNA, 23andMe, MyHeritage, FamilyTreeDNA (Family Finder), Illumina, Gene by Gene, and National Geographic (Geno 2.0).

The instructions differ slightly depending on whether you already have a Living DNA account.

If you already have a Living DNA account

STEP (1): Log in to Living DNA. At the top right hand corner click on the drop down arrow next to your name and click on "Profiles". At the top of the screen you will see an "Upload DNA file" option.

Go to STEP 2 (below).

If you are new to Living DNA

STEP (1): Visit Living DNA via the following link: https://livingdna.com/uk/free-dna-upload and click on "Upload your DNA for FREE today".

Whether or not you previously had a Living DNA account

STEP (2): Fill in the required details, selecting whether the test is for yourself or someone else. Note that you must have permission to upload someone else's data.

STEP (3): At the next screen add your raw DNA data file.

STEP (4): You will be asked whether you wish to opt in to Family Networks, in other words matching. Say "yes" to this to get DNA matches.

You will then work through screens asking you to provde a username an optional profile picture,

That’s it, all done! You just have to wait for the file to be processed to see your matches. The next screen will offer you the opportunity to upgrade (pay) to gain access to the additional tools but you do not need to do this to get started.

(These instructions and screenshots are current at the time of publishing but the exact layout of the screen and where on the page to click may change with time).

How to download DNA data from and upload to FamilyTreeDNA (FTDNA)

Sat, 02 Nov 2024 15:44:04 GMT

Please make sure that YOU are happy with any terms and conditions and privacy policies before proceeding through the various screens.

There are two parts to this article:

Downloading your data from FamilyTreeDNA
Uploading a new test to FamilyTreeDNA

Downloading your DNA Data from FamilyTreeDNA

STEP (1): Log in to FamilyTreeDNA. In the "Autosomal DNA" box, click on "See More" then "Data Download", as shown in the image.

STEP (2): At the next screen there is only one option, click on "Build 37 Concatenated Raw Data".

STEP (3): That’s it, all done! You should now have a file with a name starting ’37K_[your name]” ready to upload to other websites.

Uploading DNA data to FamilyTreeDNA from elsewhere

FamilyTreeDNA is one of the websites that accepts uploads from elsewhere. This means you don't have to pay for a FamilyTreeDNA test to get FamilyTreeDNA matches. There is a small fee to unlock some of the DNA tools but this is usually cheaper than the cost of a DNA test.

Which tests can be uploaded to FamilyTreeDNA?

FamilyTreeDNA accepts uploads from AncestryDNA, 23andMe (V3, V4, and V5) and MyHeritage (Results received after March 1, 2019)

STEP (1): Visit Family Tree DNA at the following link: https://www.familytreedna.com/autosomal-transfer

STEP (2): Fill in the details required and click “Join Today!” or log in, if you have an account already that does not include an autosomal (Family Finder) DNA test.

STEP (3): The next screen asks you what type of kit you are uploading. In this case we are uploading an AncestryDNA kit. Add your raw data file and click “Submit”.

STEP (4): Wait to see a confirmation message:

STEP (5): Click on "Go to myFTDNA" to enter more account details and agree to the Terms and Condictions. You will also be asked to choose whether to consent to participate in both matching and Investigative Genetic Genealogy (use for law enforcement).

That’s it, all done! You just have to wait for the file to be processed to see your matches.

(These instructions and screenshots are current at the time of publishing but the exact layout of the screen and where on the page to click may change with time).

How to download DNA data from MyHeritage

Sat, 02 Nov 2024 15:39:53 GMT

Please make sure that YOU are happy with any terms and conditions and privacy policies before proceeding through the various screens.

Downloading your DNA Data from My Heritage

STEP (1): Log in to your My Heritage account and click on the “DNA” tab at the top of the screen, and then “Manage DNA kits”.

STEP (2): Click on the three dots at the end of the row for the kit of interest and then “Download kit”.

STEP (3): Read through the information about your DNA download and click “Continue”.

STEP (4): Read the terms, check the tick box and click “Continue”. And that's it, you will shortly receive an email from which you can download your raw DNA data.

How to download DNA data from Ancestry

Sat, 02 Nov 2024 15:37:57 GMT

Please make sure that YOU are happy with any terms and conditions and privacy policies before proceeding through the various screens.

STEP (1): Log in to your Ancestry account. Click on the profile icon in the top right hand corner (this may differ on a tablet or mobile device), and select "Account Settings".

STEP (2): In the left menu select "DNA". You will see a list of your own tests and any tests you manage.

STEP (3): Select the test of interest and scroll down the page that follows until you see the "Download or delete" section.

STEP (4): Click on Download DNA data and accept the terms of the download.

STEP (4): Press Continue and then following the extra security check step (enter password or receive email). And that's it, you will shortly receive an email from which you can download your raw DNA data.

That’s it, all done!

(These instructions and screenshots are current at the time of publishing but the exact layout of the screen and where on the page to click may change with time).

How to download DNA data from 23andMe

Sat, 02 Nov 2024 15:36:48 GMT

Please make sure that YOU are happy with any terms and conditions and privacy policies before proceeding through the various screens.

STEP (1): Log in to your 23andMe account.

STEP (2): Click on the search option next to your profile icon:

STEP (3): Start to type "download" in the search box and you will see the option to "Download your raw genotyping data". Click on this:

STEP (4): The next screen asks for your data of birth as a security check.

STEP (5): At the screen after the security check, you will either see a message saying your data is ready to download or a message telling you that you will recive an email when it is ready. When it is ready, click the download button.

That’s it, all done!

(These instructions and screenshots are current at the time of publishing but the exact layout of the screen and where on the page to click may change with time).

GRO BMD indexes and cheaper PDF and digital certificate options

Sun, 06 Oct 2024 15:01:20 GMT

This is an updated version of a post first published in November 2016.

NEW indexes

On 3rd November 2016 the General Register Office (GRO) quietly launched its own version of birth and death indexes via its usual Certificate Ordering Service .

What’s New?

Once logged in (it's a free account to set up), you are now represented with options to buy certificates or search the indexes:

At the time of update only the births for 1837-1934 & 1984-2022 and deaths for 1837-1957 & 1984-2022 can be searched. The indexes were created from an old digitisation project that was cancelled midway through, before including marriages, so you will only find births and deaths in these new indexes .

Why is this so exciting for family historians?

The original GRO BMD indexes are available on multiple websites, such as Ancestry, Find My Past and FreeBMD. These websites are all based on the same data, the original (old) GRO indexes. These new indexes have been created afresh from the register images themselves, they are brand new! This means that where you have been unable to find an entry before due to errors in the GRO indexes available on the major websites, there is a chance that the new index may include your entry. On the downside, it is likely that different errors have been introduced.

More importantly though:

The new birth indexes include mother’s maiden name for births BEFORE 1911 (currently available 1837-1924).

The new death indexes include age at death for deaths BEFORE 1865 .

This can make it really easy to find or confirm which birth or death entry is correct before having to order multiple certificates.

What can the new indexes reveal?

Here’s an example of how the new indexes can help. My great great grandparents, Joseph Hopkins and Isabella Wells, were recorded on the 1911 census as having had ten children, only five of whom had survived until 1911. I had identified nine children using a variety of sources, and a family grave lead me to believe the tenth child was an Edmund Hopkins. Searches for birth and deaths had so far been unsuccessful.

I used the new birth indexes to identify any Hopkins children born in the Aston or Birmingham registration districts in a twenty year period from Joseph and Isabella Wells’ marriage in 1869, with mother’s maiden name Wells. One birth appeared that I had not found before:

A search of the new death indexes to find an Edward James Hopkins who died between 1888 and the 1891 census found only:

It therefore seems that there is an error on my family grave. The missing child was Edward not Edmund. Excited to have potentially solved this puzzle I ordered both the birth and death for confirmation.

Using the new search

The new search, whilst offering the potential to solve problems, is not exactly user friendly. A search range of only +/- 2 years is possible and males and females have to be searched for separately. A screen shot of the birth search screen can be seen below:

It is not possible to use wildcards in the search though there are options for “sounds similar” and “phonetically similar” searches. Strictly speaking a woman's maiden name is the name she had at the time of her marriage. An unmarried mother therefore does not have a maiden name. This is reflected in the new indexes with a – in place of a name in these new indexes.

Ordering certificates

You will notice from the screenshots above that when you select an entry in your search results you are presented with a number of formats in which to order the entry. Paper certificates that arrive through the post on coloured paper can still be ordered, at a standard cost of £12.50*, but there are now other options too.

PDF copies

Pdf copies are available at a cost of £8.00 for the following years*:

Births: 1837 – 1923
Deaths: 1837 – 1957

Pdf copies contain the same information as the printed certificates, albeit in a more "basic" looking presentation. An example of a pdf copy certificate is shown below. This is the certificate I searched for earlier, and the parents' details confirm that this is the child of interest.

Digital copies

Digital copies can be downloaded as soon as your payment has completed. They are truncated compared to pdf and paper certificates and do not include the column headings, but do include the entry of interest in the register. Digital copies are available at a cost of £3.00 for the following years*:

Births: 1837 – 1923

Deaths: 1837 – 1957

An example digital copy of a birth register entry is shown below for comparison:

Certificate and pdf copies can be ordered both from the index search screen and by going straight to "place an order" screen if you have the GRO reference already from elsewhere. Digital copies are only available through the index searches. Note that pdf and digital copies are only available for birth and death entries (not marriages) and within the year ranges given above, at the time of writing.

* prices and year ranges correct at the time of writing, but subject to change.

Ordering from elsewhere

If you are ordering copies of General Register Office certificates for England and Wales, please only order them through the GRO's Certificate Ordering Service . Copies are available through other website but these usually add on additional fees which can be quite high.

Alternative copies may also be available at the local register office appropriate for the place in question.

Calling all Cowlings!

Sat, 05 Oct 2024 16:34:12 GMT

I have blogged about members of my Cowling family a few times, including my recent post: the Cowlings of Cambridgeshire .

Today I would like to invite all Cowlings and Cowling researchers to get involved with the Cowling One Name Study Project and encourage you to join the Cowling DNA Project .

My own research is so far based in Cambridgeshire but the projects are ultimately worldwide in scope. My ancestor, Sell Cowling, was born in c.1775, probably in Cambridgeshire, and raised his children in the village of Ickleton but here I get stuck. There were lots of Cowlings (sometimes Cowlins or Cowlands) in Cambridgeshire and I have a couple of “possibilities” in terms of his parish of birth, but there are also some gaps in the records.

I began to expand my searches to other parishes in Cambridgeshire and then into neighbouring counties and then realised what I really wanted to know was: how do all these Cowlings fit together? Are all Cambridgeshire Cowlings related? If we look at surname distributions maps we see two areas of concentration: one in Yorkshire (most probably arising from places of the same name) and one in Cornwall. Are these two separate groups or are they all related?

In order to find out more I decided my next step was to take a step back from my particular research problem and look at the bigger picture: looking at all Cowlings and how they may fit together. I registered the Cowling One Name Study with both the Guild of One Name Studies and The Surname Society and you can find out more about investigations so far via the link to the study page here . So far the traditional genealogy research route has been slow, due to time constraints, but I have begun to pull together family groups for all the Cambridgeshire Cowlings and am actively collecting data for England and Wales as a whole. This is a very different type of research than my usual professional genealogy work, it has to be, due to the volume of data collected and I am enjoying learning different methodologies and techniques as I go.

However, I can’t claim “ownership” for all Cowlings of course, I have just decided to formalise the project. This is a collaborative effort. If you would like to contribute or share your own research please get in touch. I will certainly be sharing everything I find.

Traditional research is only one approach. You may have noticed I have a particular interest in the uses of DNA testing in genealogy. This a fantastic tool when looking at a surname study. I have already made contact with a number of my father’s 5th cousins and DNA matches in Australia, all of whom descend from the same grandson of Sell Cowling who emigrated there:

However, the Ancestry test is an autosomal DNA test and matches will only be found with those with common ancestors in more recent generations. As we move beyond fifth cousins we will be less likely to find DNA matches using this type of test.

Instead we need Y-DNA. This traces the patrilineal line – the father of the father of the father etc – going back many generations and is what we need to work out whether all these branches are indeed connected. I have set up a Y-DNA project at Family Tree DNA here .

If you are a male Cowling by birth / know of one in your family and would either be willing to take a Y-DNA test or would like to find out more (no pressure!) then PLEASE do get in touch. Contact me before purchasing a test as I can get a better price through my Guild DNA project.

I have also recently set up a Cowling ONS Facebook page .

This is a place to share photographs and Cowling stories and share research updates. Do pop by and say “hello”.

Demystifying DNA 4: autosomal DNA tests

Fri, 04 Oct 2024 16:45:37 GMT

Originally posted 6th September 2018, updated 4th October 2024.

In my series of posts about Demystifying DNA testing for use in family history this is probably the type of testing most people want to hear about: autosomal DNA testing. In other words, the tests used by Ancestry, 23andMe, My Heritage, Family Tree DNA (the Family Finder test) and Living DNA to find matches with close relatives, matches where the common ancestor is only 5-7 generations ago. Autosomal DNA testing is also known as “close cousin” testing, because it is used for closer generations than Y-DNA and mtDNA.

This is the type of testing taken by the highest number of people and the type of testing most likely to generate matches to your own known family names.

Before we get into where to test and how to use your matches we need to look at the science some more to ensure we will get the most from the data.

Autosomal DNA: The “Sciencey” Bit

Remember from the first post in this series the image that showed your autosomal DNA? Here is it again:

Here we are interested in the numbers 1 to 22: our 22 pairs of autosomal chromosomes .

For each pair, one chromosome came from our father and one from our mother, in its entirety. So, for example, looking at Chromosome 1, perhaps the left hand chromosome came from our father and the right hand side from our mother.

It is how we inherit autosomal DNA that makes it such a powerful tool for use with family history research.

The Inheritance of Autosomal DNA

The creation of eggs and sperm, in which DNA is passed from parent to child, occurs by a process called meiosis. During meiosis each chromosome is duplicated resulting in four copies of each chromosome, two paternal copies (in blue below) and two maternal copies (purple). DNA is then exchanged between the four copies, a process called recombination , which essentially mixes up the paternal and maternal DNA. Only one of the four chromosomes is passed on in the egg or sperm. You don’t need to worry about the detail, the important part is that the two of each chromosome a parent has are mixed up so that a child receives a combination of both.

Let’s take this a step further with an example: the descent of DNA from a couple, John and Mary. We will just look at one chromosome pair but the same principle applies to all 22 chromosome pairs. In all cases we will assume that the left chromosome came from the father and the right from the mother. So, John’s blue chromosome is from his father and the purple from his mother, and so on.

John and Mary have two children: Thomas and Sarah. Each child gets 50% of the DNA from their father and 50% from their mother, but in different combinations. Thomas gets two sections of blue from John and two sections of purple. Sarah gets the top half of the blue and the bottom half of the purple. They have each inherited DNA from their father but they have not inherited exactly the same DNA. The way in which they inherit from Mary is also different from one another. On average siblings share about 50% of their DNA but there is a range , as we will discuss further later.

Next we look at the case where Thomas and Sarah and have children of their own:

Here we see that Robert’s paternal chromosome (the one on the left) is a combination of the two chromosomes for Thomas. He has some sections, or segments, of DNA from both of John’s chromosomes, and some from both of Mary’s chromosomes.

Robert’s cousin Elizabeth, also has segments of DNA from all four of John and Mary’s chromosomes but Robert’s and Elizabeth’s DNA are different from one another. On average first cousins share 12.5% of their DNA .

There’s a really important point to note here. A grandchild CANNOT inherit DNA from his grandparent that was not passed from grandparent to parent . Look back to the example above. Robert cannot have the top portion of the purple chromosome of John’s, because John did not pass it to Thomas. Likewise, Elizabeth cannot have the bottom section of the blue chromosome, because John did not pass it to Sarah.

We have started to talk about the percentage of DNA you receive from different ancestors. The further back in time you go, the less DNA you share with your ancestors on average:

In fact, the amount you share with your distant ancestors eventually becomes so small that there is a chance that you will not share any DNA at all. This is the second important point: You do not inherit autosomal DNA from every one of your ancestors . Whilst all of your ancestors are included in your genealogical family tree, even if some of them are yet to be identified, not all of your ancestors are included on what we call your genetic family tree . The genetic family tree is shown below, DNA is only shared with those ancestors shaded in grey:

This could potentially be very frustrating if your aim was to find links to one of your great x 4 grandparents shown in white above. However, remember, the process of recombination is different each time. You may not have inherited DNA from that particular ancestor but your siblings, aunts and uncles etc may well have done. This is why it is always worth testing as many family members can you can.

Uses of Autosomal DNA

The primary use of autosomal DNA is for finding connections with those descended from common ancestors in recent generations, your close cousins.

Potential uses of this type of testing include:

Confirming your family history research carried out so far using traditional research techniques
Expanding your family tree by connecting to those with whom you share DNA
Finding the answer to a particular problem or breaking down a brick wall
Use by adoptees searching for birth relatives

Who can take a test?

Both males and females can take autosomal DNA tests and will find cousins in the same way.

The Data

So how do the tests work? When we talked about Y-DNA and mtDNA tests we talked about the raw data or comparing the raw data to reference standards. When your autosomal DNA is analysed data is collected at around 600,000-700,000 SNPs or positions. Rather than compare raw data the commercial companies do the data crunching for us using matching algorithms and we are presented with a list of matches. Here’s an example of some matches, taken from the Ancestry website:

You can see that for each match there are one or more suggested relationships. The average amounts of DNA shared with some of your relatives are shown in the table below ( from the ISOGG website ):

You can see that some relationships share about the same amount of DNA. In fact, beyond the parent child relationship, there is always more than one possible relationship for an amount of shared DNA . Don’t worry too much about what a cM is at this stage, just think of it as an amount of DNA.

For the Ancestry DNA matches shown above, some matches have a single relationship given, some have a couple of options. What you are seeing here is the website trying to help you by giving the most likely relationship, but do not take this as the definitive answer. If you click on any of the relationships shown you will arrive at a screen with more detail. This is what is shown for my 147 cM match:

The screen actually cuts off and needs scrolling, and the number of relationships grows until there are relationships with a 0.03% likelihood. This is all starting to look very complicated isn't it? I mention this because it can be too easy just to look at your match list and then spend hours trying to fit a match into the "correct" relationship in your family tree and failing, simply because there are also other correct answers. By all means use the most likely relationship as your starting point when trying to fit match into your family tree, but bear in mind that there are likely to be other possibilities too. There are some great tools for looking at the relationships likely from a given amount of shared DNA, the most popular are the Shared cM Tool and the My Heritage cM Explainer . You can read more about using these tools in an earlier blog post .

If you get confused about first, second and third cousins or what once or twice removed means, the following table may help:

Investigating matches

Once you have discovered some matches to your DNA data the next step is to start to work out how they connect to your family tree. They may have a family tree uploaded themselves and you may see familiar names. You may feel sure you know where there is a link and either need to work on your tree or theirs to bring the two together.

The ease with which you can link to your connections will depend on how extensive the research is so far by both of you and how distant the proposed relationship. You can improve your chance of success with working out who your matches are by working on descendant lines in your family tree to identify as many cousins as you can on your lines of most interest.

Another very powerful tool is to look at shared matches , that is people who share DNA with you and the match you are interested in. If your match of interest does not have an extensive family tree, your shared matches may do. You can take this a step further by target testing known relatives from the part of your family tree of interest. Some of the websites have already started this process by attempting to split your matches into your paternal and maternal side. Any shared matches in common will likely share ancestors in this part of your family tree.

Your can start to group matches that you know to be from one part of your family tree on the website with coloured tags or use something called clustering to have tools form those groups for you. This kind of analysis is beyond the scope of this introduction to testing.

The Testing Companies

Autosomal tests are available at all of the big 5 DNA companies:

Ancestry DNA: offers matches and amount of shared DNA but gives no chromosome data. Data can be downloaded for upload elsewhere.
23andMe: offers matches and amount of shared DNA but (currently) gives no chromosome data. Data can be downloaded for upload elsewhere.
Family Tree DNA and My Heritage: offer matches, amount of shared DNA and chromosome data. Both have has a chromosome browser to examine data in more detail, which adds weight to your comparison of family trees. Data can be downloaded for upload elsewhere.
Living DNA: more focus on providing estimates of geographical origins and its selling point is that is provides a more detailed breakdown for those with UK heritage than other companies. Some matching data. Data can be downloaded for upload elsewhere.

Family Tree DNA, My Heritage and Living DNA offer free upload of data from other companies (though you will have to pay to use all of the tools available).

In Summary

This is only an introduction to autosomal DNA testing, to give you a flavour of what can be achieved. There is much more to add and many tools and external websites that can be used to look at the data and matches in more detail.

If you want to learn more you may be interested in my five week online course with Pharos Tutors®, Demystifying DNA for Family Historians .

Demystifying DNA 3: mitochondrial DNA (mtDNA) tests

Fri, 04 Oct 2024 11:07:52 GMT

Originally posted 2nd August 2018, updated 4th October 2024.

This is the third in my series of posts attempting to demystify DNA testing for family historians. If you would like an overview to the many types of DNA test, do see the introduction to DNA testing post. In my last blog we looked at Y-DNA testing in more detail : when to use Y-DNA, who can test, where to test and how to interpret the results.

This month we move onto mitochondrial DNA, or mtDNA, testing.

Uses of mitochondrial DNA (mtDNA)

Mitochondrial DNA is to maternal research what Y-DNA testing is to paternal research as illustrated by the following schematic:

mtDNA is specific to the matrilineal (female to female) line, looking at your mother, her mother, her mother’s mother and so on. It does not include ALL of your mother’s ancestors, just those highlighted above. The difference to Y-DNA however, is that everyone has mtDNA. A mother passes on mtDNA to all of her children, males and females, but only females pass it on to the next generation. So a male can take a mtDNA test to find out about his matrilineal line.

Just like Y-DNA, mtDNA is passed largely unchanged from one generation to another, enabling its use for tracing maternal ancient origins. You can also, in theory, use mtDNA to support your genealogy research. However this is complicated by the fact that the surname changes at every generation, making traditional research more challenging, and the way in which mtDNA mutates.

Every now and again a mutation or copying error occurs with mtDNA, moving from one generation to the next. When I use the term “mutation” here I simply mean a change in DNA, no implication of anything to do with health. The main difference between the inheritance of mtDNA compared to Y-DNA is that the mutation rate of mtDNA is slower. A mtDNA match could share a common ancestor with you in recent generations or hundreds or even thousands of years ago.

mtDNA is therefore not as useful for testing speculatively to find matches, as it is less likely that a mtDNA match will share with you a common ancestor in a genealogically relevant timeframe. The beauty of a match on mtDNA is the fact that you will know what small section of your family tree the match is connected to. Where mtDNA is particularly useful is for confirming suspected relationships. It is a very powerful test for comparing your own data with a suspected match to see if you are indeed related to the same maternal ancestor. This approach can equally be applied to adoption cases as to the situation where you have two candidates for your maternal great grandmother.

Who can take a test?

Contrary to popular belief, mtDNA tests can actually be taken by both males and females. mtDNA passes from a mother to her children, the difference being that only the females then pass this mtDNA on. This is illustrated more clearly by the following schematic:

In the diagram, the descendants of a couple are shown. They have three children: two girls and a boy. The spouses of these three children are shown in grey to indicate they are not blood relatives of the couple at the top. All of the descendants of the uppermost female, who carry her mtDNA are shown in pink. This means that there are some females and some males coloured in pink. In the middle is a female filled in in green. Her father received mtDNA from his mother, but males do not pass on mtDNA to their children. The lady in green therefore does not carry her paternal grandmother's mtDNA.

Let's assume that this green female is the genealogist of the family and she wants to know more about her paternal grandmother's matrilineal (female to female) line. Unfortunately, her grandmother died some years ago. Looking at the diagram you can see that she has options to ask not only her aunts and first cousins, but also her father could take a mtDNA test to represent her grandmother's mtDNA. What if there are no surviving relatives to test? Just like with Y-DNA, mtDNA remains unchanged for many generations, so you could go back another generation to our genealogist's great grandmother, and look at other any female to female line descendants in the form of second cousins, and so on.

Generally speaking, if you have a choice, test the older generation. This approach does assume that all those in pink are the blood line of the uppermost female. A misattributed paternity event is a possibility and you should always test more than one candidate from more than one line of descent if you can.

Types of Test

Mitochondrial DNA is a circle of DNA, consisting of 16,569 base pairs (see the first post in this series, the introduction to DNA , for an explanation of the terminology). Mitochondrial DNA consists of the following regions:

The area shown in white represents the hyper variable control regions (HVR1 & HVR2). These are the areas of the mtDNA known to mutate more quickly. They are therefore more likely to differ from one individual to another, unless they are closely related. The coding region undergoes changes less frequently.

The first mtDNA tests analysed DNA in the HVR1 and HVR2 control regions only. Later mtDNA tests included both the HVR1 & HVR2 regions and the coding region. Testing originally used SNP testing . Remember from the piece on Y-DNA testing, a Single Nucleotide Polymorph, or SNP, is a point along the DNA molecule known to differ from one individual to another – a point at which a mutation has occurred at some point in time. SNP (pronounced “snip”) testing analyses which nucleotide is found at many individual locations or SNPs.

Also available for mtDNA are sequence tests . Rather than look at individual SNPs all base pairs are analysed in the region of interest. Early tests just looked at the base pairs in the HVR1 or HVR1 and HVR2 regions. Now the standard is a full sequence test , which analyses all 16,569 base pairs. In much the same way as a higher number of markers on a Y-DNA STR tests gives you better data for comparison with others, more accurate mtDNA data is found with a full sequence test.

If we imagine the ring of DNA opened out flat then a visual representation of the difference is:

The Data

When we looked at the Y-DNA STR tests we looked directly at the number of repeats at STR markers or the identity of bases at particular locations. mtDNA data analysis is different. Here we compare how each individual differs from reference standards. The first produced was the Cambridge Reference Standard (CRS), now superseded by the corrected revised Cambridge Reference Standard (rCRS) , based on a European who had haplogroup H. A second standard, the Reconstructed Sapiens Reference Sequence (RSRS) , was produced more recently and was an attempt to compare mtDNA against a reference with an older haplogroup, closer to Mitochondrial Eve (see below for more on haplogroups). The details of the two standards are not appropriate here, more information can be found at the ISOGG website . It is, however, important to know which standard has been used by your testing company of choice if you are to compare results with those obtained elsewhere.

Family Tree DNA supplies results against both reference standards. The images below show the (truncated) results of my own mtDNA test against the rCRS at Family Tree DNA.

The results are actually reported in two ways, just to confuse you! In this case there are no differences to the standard in the HVR1 region. In the HVR2 region five differences are shown. The traditional way of reporting these is to the give the position number, followed by the letter of the base that you have compared to the original. So at position 152 I have C instead of the base of the rCRS. The second set of data (the lower table labelled “Revised Cambridge Reference Standard”) actually shows this more simply. It shows you that there should be a T at position 152 but I have a C.

The addition of a “.1” indicates an addition at this position. In fact I have two additional Cs at position 309. If a base is missing at a particular position it would be marked e.g. 309-, known as a deletion .

Now let’s turn our attention to the RSRS results, again my own (truncated) data:

There are some differences against the reference standard in the HVR1 region here. This is to be expected: The reference for the rCRS was in haplogroup H, as am I, whereas the reference for RSRS is based on older haplogroups. Here differences are marked:

<reference base> POSITION NUMBER <your result>

so you can readily compare the base in the reference standard with your own. For the RSRS results there are also extra mutations and missing mutations . These refer to differences from what is expected for my haplogroup compared to the RSRS.

My current matches on mtDNA are shown below:

As you can see, I don’t yet have any matches at genetic distance of zero (this post was original published in 2018 and now, in 2024, I still do not have any zero genetic distance matches!). A genetic difference of 1 means that there is a difference in my data compared to the other test taker’s data at one position, whether it be a different base, an addition or a missing mutation compared to their results.

With Y-DNA we could calculate a reasonable estimate of the time to Most Recent Common Ancestor (MRCA) as Y-DNA mutations happen at a regular rate and there is some level of confidence in predictability. As I said earlier, with mtDNA the mutation rates are much slower and there is much greater range. The following table is taken from the Family Tree DNA website. Even if I had a match with a genetic distance of zero there’s only a 50% likelihood that person and I share an ancestor within 5 generations. It’s more likely that the common ancestor is somewhere within the last 5-22 generations.

Mitochondrial DNA (mtDNA) haplogroups

What I find interesting is knowledge of my mtDNA haplogroup. Just as there is a haplogroup tree for Y-DNA, there is an equivalent mtDNA haplogroup tree, as all females are descended from mitochondrial Eve. An individual’s mtDNA haplogroup is their location in the human mtDNA haplogroup tree. Everyone fits on this tree, some branches dating far further back in time than those derived from more recent mutations. A simple graphic is shown below but there are many branches, or subclades, within each haplogroup.

Each haplogroup is connected to particular time and place and more information on where the haplogroups originated can be found here: mtDNA haplogroups. My own haplogroup is H. This is a predominantly European haplogroup as I would expect and does not reveal anything exciting about my own family history. However, for those with a family story that 3x great grandmother was a local Indian girl that 3 x great grandfather met while he worked in British India, discovering the haplogroup can be very important.

The Testing Companies

I’m only considering the main five DNA testing companies in this series of blogs, to keep things simple. Of these, only Family Tree DNA currently offers separate mtDNA tests with matching and, in 2024 only the full sequence test remains available.

Whilst the other DNA companies in “the big five” do not offer a separate mtDNA tests, both Living DNA and 23 and Me includes measurement of 4000+ positions on the mtDNA genome to define the haplogroup (data source: ISOGG wiki, MtDNA testing comparison chart ).

Remember

Be careful with haplogroups – Y-DNA and mtDNA lettering conventions do not relate to one another. The Y-DNA haplogroup is an indication of paternal origins, the mtDNA haplogroup an indication of maternal origins . A man has both, a woman has only a mtDNA haplogroup.

As with all DNA tests, the number of matches you get with mtDNA testing will depend on who else has tested. If you have no matches to start with: be patient.

With any type of DNA test, the results obtained form only part of the analysis. DNA testing does not answer questions alone: it must always be assessed along with other information and documentary evidence.

Up Next

The next post will focus on the most popular type of DNA testing now: autosomal DNA, the type of test offered by Ancestry, My Heritage and Family Tree DNA (the Family Finder test) to find matches to close living relatives.

Demystifying DNA 2: Y-DNA tests

Fri, 04 Oct 2024 09:47:40 GMT

Originally posted 1st July 2018, updated 4th October 2024.

In my last blog we looked at the science behind DNA testing and the different types of test available . In these next few posts in the series we will look at each type of DNA testing in more detail.

Uses of Y-DNA

Y-DNA is passed from father to son, unchanged for many generations, and this makes it a powerful tool for assessing your paternal line: a match on a Y-DNA test can only lead you up one part of your family tree.

Y-DNA is often used by those running surname studies as, in principle, the descent of the male line is the same as the descent of the surname. Y-DNA can therefore be used to assess the likelihood of all bearers of a particular surname arising from the same single individual, no matter how far back in time this individual lived. There are single surname DNA projects through the commercial testing sites and a number of One-Name Studies (ONS) also operate DNA projects.

However, surnames do not always reflect bloodlines. The most common issue is the bearer of a surname being found to be illegitimate: Mr Postlethwaite was actually a plain old Mr Brown. In DNA circles this is referred to as a “non-paternity event” or "not the parent expected" (NPE), or "misattributed parent event" (MPE). There are a number of other reasons a surname may be assumed: unofficial adoption, taking on a stepfather’s surname and so on.

Y-DNA can also be used to identify an unknown father, though this use has been largely replaced with autosomal DNA tests now for recent generations. The caveat for Y-DNA is that the results may point to a particular male line but not necessarily an individual within that line. Just using Y-DNA testing could point to Mr A being the father, but equally his brother, his paternal cousin or his uncle. As with all types of DNA test, the DNA data is just one source of information that can be used to aid genealogical research . It needs to be used in the context of known information and documentary research, in this case, who was in the right place at the right time?

Who can take a test?

Y-DNA tests can only be taken by males. However, the power of the Y-DNA chromosome is that it is unchanged over many generations. If you have no brothers you can ask a cousin to test, or an uncle, or even a second or third cousin, So long as they are from an unbroken line of males from your common ancestor. The Y-DNA carrying descendants of an individual are illustrated below:

In the diagram, the descendants of a couple are shown. They have three children: two boys and a girl. The spouses of these three children are shown in grey to indicate they are not blood relatives of the couple at the top. The male descendants of the uppermost male, who descend through the male to male line and therefore carry Y-DNA, are coloured in blue. In the middle is a male filled in in green to show that, whilst he descends from the uppermost male, he descends via a daughter and therefore does not carry the same Y-DNA as those shown in blue i.e. the chain of descent for this green male is not male to male to male.

Let's assume that this green male is the genealogist of the family and he wants to know more about his maternal grandfather's patrilineal (male to male) line. Unfortunately, his grandfather died some years ago. Looking at the diagram you can see that he has options to ask both uncles and first cousins to take a test to represent his grandfather's Y-DNA. What if there are no surviving cousins or uncles to test? The joy of Y-DNA is that it remains unchanged for many generations, so you could go back another generation to our genealogist's great grandfather, and look at other any male to male descendants in the form of second cousins, and so on.

Generally speaking, if you have a choice, test the older generation. This approach does assume that all those in blue are the blood line of the uppermost male. A non-paternity event is a possibility and you should always test more than one candidate from more than one line of descent if you can.

The Data

There are two different methods of analysing and comparing Y-DNA:

STR or Short Tandem Repeat testing
SNP or Single Nucleotide Polymorph testing

STR Testing

Short Tandem Repeats (STRs) are positions along the DNA molecule where the same sequence of nucleotides or bases is characteristically repeated a number of times. For example, if at a particular position of the DNA molecule the bases were AGTCAGTCAGTCAGTCAGTC, the sequence AGTC is repeated five times.

Each STR marker is named, typically in the format DYS391 (where D = DNA, Y = Y chromosome and S = (unique) segment). The number of times the sequence is repeated at each marker is counted and the results of the Y-DNA test take the format shown below:

This set of results is called an individual’s haplotype . When purchasing a Y-DNA test you will see notations like Y-37, Y-67 and Y-111. These are the number of STR markers, or locations on the DNA molecule, tested. The example above tested at 12 markers only (there are two results at DYS385). Whilst early tests could only look at 12 markers, 37, 67 and 111 markers then became more common as the technology has developed, with some tests looking at even greater numbers of markers. Family Tree DNA now only sells the Y-37 and Y-111 tests (plus the Big Y, which we will come back to). You can still compare results with someone who tested with a different number of markers: a test at 37 markers looks at the same 12 markers as a 12 marker test, plus an additional 25, and so on.

The results of the STR tests are compared with those of others on the commercial websites to see if they are matches , i.e. have the same count of repeats at each marker tested. If all results match exactly the tester and match are said to have a genetic distance of zero. In the example above, if another set of results was compared and all were the same except the result for DYS391 was 9 instead of 10, this would be termed a genetic distance of one. If DYS391 was 9 and DYS426 was 13 this would be a genetic distance of 3, i.e. the difference of 1 at DYS391 plus the 2 on DYS426 (this is calculated in a slightly different way when you have more than one result at a marker, but this gives you the general idea).

The number of markers tested matters. If you have an exact match at 12 or 25 markers this does not necessarily mean you are closely related. A comparison of 67 markers is looking in more detail at the DNA and could reveal that there are actually large differences in the results. It's a bit like saying two men live in Yorkshire so are identical at 12 markers, but at 111 markers you are testing whether two men live at 49 Horton Grange Road, Bradford, Yorkshire.

Fortunately, you do not have to work any of this out yourself. At Family Tree DNA the Time Predictor tool is used to predict when the likely Most Recent Common Ancestor (MRCA) with a match lived, taking into account both the number of markers tested and the genetic distance value. The example below shows two men who have taken a Y-111 test and match with a genetic distance of 1. The Time Predictor report is access by clicking on the calendar icon highlighted in the image below. The Time Predictor report predicts the two individuals to share a common ancestor born in around 1850, with a range 1700-1900.

For many years STR testing was the backbone of matching with Y-DNA, and it certainly remains the most affordable type of testing. However, in recent years, the advances in technology and increasing numbers of those testing have meant that SNP testing , traditionally associated with looking at ancient origins and haplogroups , can also be useful in a genealogically relevant time frame .

SNP testing

A Single Nucleotide Polymorph (SNP, pronounced “snip”) is a point along the DNA molecule known to differ from one individual to another – a point at which a mutation has occurred at some point in time. Rather than test areas of repeating nucleotide sequence like STR testing, this type of testing analyses which nucleotide is found at many individual locations or SNPs (pronounced “snips”).

Haplogroups and Mutations

An individual’s haplogroup is their location in the human Y-DNA haplogroup tree . Every male fits on this tree, some branches dating far further back in time than others. Traditionally, haplogroups were associated with looking at a male's ancient origins. A simple graphic is shown below but there are many branches, or subclades , within each haplogroup. The position of an individual on this "Y-DNA family tree" is dictated by whether or not they have mutations at particular SNP locations (i.e. have a different nucleotide, A, C, T, G, to other people). Going back to the address analogy: if two men live in Horton Grange Road they might be on the same branch, let's say haplogroup "I" on the image below. However, if one lives at number 49, for which a mutation has been identified, and the other at number 30, then only the 49 Horton Grange Road man moved down to the next branch or subclade , let's say "I1a", whilst the other man remains in haplogroup I.

Y-DNA haplogroups used to be written in the form R1a1a1b2a2a1 but as more research was conducted more and more branches discovered this quickly became unwieldy. Now the name of the haplogroup is shortened to the letter from the major haplogroup branch, follow by the final SNP at which a mutation was detected. Care needs to be taken with comparing haplogroups, as one tester may have only an estimated haplogroup and another have had SNP testing conducted to a deeper level (i.e. they may appear different but could actually be from the same higher branch).

As technology has developed it has become possible to define more and more mutations and more and more branches, some of which were created in very recent generations. This means SNP testing can also be used to look at your DNA matches and how far back in time a common ancestor may have lived.

At Family Tree DNA this more detailed analysis of STRs and SNPs is called the Big-Y700 test , which tests over 700 STRs and hundreds and thousands of SNPs. Your results will include a more detailed estimate of your haplogroup than STR testing alone, and will include "private variants", mutations not yet classified as known SNPs. Ultimately, as more people test, your haplogroup will get further defined. It is the discovery and analysis of more recent mutations / variants that makes SNP testing useful for fine-tuning the time to MRCA for two individuals. However, at around $449 US dollars, this type of testing is for the more dedicated DNA enthusiast and those involved with surname and other Y-DNA projects. A more in-depth discussion of Big Y is beyond the scope of this introduction to Y-DNA. You can read more about the Big-Y test here . You can read my review of some of the latest Y-DNA tools you can use with Big Y tests here .

The Testing Companies

Only Family Tree DNA currently offers a separate Y-DNA test, where STR results can be compared with other users. Your own STR data can also be downloaded for further analysis elsewhere. Haplogroup and SNP testing is also available from Family Tree DNA.

Whilst other DNA companies do not offer a separate Y-DNA test examining STRs and matching, some do provide the Y-haplogroup a part of their single combined DNA test: Living DNA (around 2,000 SNPs) and 23andMe around 20,000 SMPs) (data source: ISOGG wiki, Y-DNA SNP testing chart ).

Remember

Using DNA testing to solve genealogical problems is dependent on the databases of test results. If no one else from your paternal line has yet tested, you won’t get any matches. In addition, all of the commercial companies databases currently contain more results of those from the US than anywhere else. This is changing as more and more test, from all over the world. The test results are powerful but you may have to be patient.

A plea from me

Do you have any COWLING ancestors from England? I have registered a Cowling One Name Study and am interested in expanding this to incorporate a DNA Project. If you are a male Cowling descended from Cowlings in England, particularly those from Cambridgeshire, Yorkshire and Cornwall and would be interested in taking part do please get in touch. Similarly if you have Cowling relatives and are just interested in the One Name Study, do get in touch too. I would love to hear from you.

Up next

The next post will focus on mtDNA (mitochondrial DNA) , the DNA we can use to assess ancient origins on the female line.

Demystifying DNA 1: Introduction to DNA Testing

Mon, 30 Sep 2024 13:21:21 GMT

Originally posted 2nd June 2018, updated 30th September 2024.

DNA testing is becoming a more and more important part of genealogical research. It is estimated that around 38 million people have now been tested, over 25 million of those with AncestryDNA. Should you test and why? With so many tests available and so many companies to choose from it can be difficult to know where to start.

This is the first in a series of articles that starts at the beginning, demystifying all that is DNA testing in genealogy.

The Tests

There is more than one type of DNA, and the test you choose will depend on what you are using DNA to look for:

Y-DNA testing
mtDNA (mitochondrial DNA) testing
autosomal DNA testing
X-DNA testing (included with some autosomal tests, not a separate test)
deep ancestry, ancestral regions or 'ethnicity' tests (included with some autosomal tests, not a separate test)

The Testing Companies

Some companies offer individual tests and some offer more than one type of data from a single test. The major testing companies are:

The "Sciencey" Bit

Before we get into the detail of what each type of DNA testing looks at and why you should choose a particular test, let’s start with the “sciencey bit”, keeping things simple.

DNA exists within almost every cell of the human body and contains long strings of nucleotides containing bases : adenine, cytosine, guanine and thymine, more commonly referred to as A, C, G and T . I am sure you are familiar with the double helix structure of DNA illustrated above. This is actually two DNA strands woven together, the interaction of the bases of one strand (blue circles) with the other (purple circles) forming the ladder like construction of base pairs , A always pairs with T and C always pairs with G.

Most of the tests we are interested in are concerned with the DNA within the nucleus of each cell. This DNA is packaged into chromosomes and the chromosomes are grouped in chromosome pairs of two similar, but not identical chromosomes. This relationship is illustrated, thus:

We have 22 pairs of chromosomes, known as autosomes , and a 23rd pair, the sex chromosomes. Females have two X chromosomes in this pair and males have one X chromosome and one Y chromosome . Chromosome pairs are shown below in an arrangement known as the human karyotype :

So already you can start to see where the Y-DNA, X-DNA and autosomal DNA tests come in.

The last type of DNA is a special case. Mitochondrial DNA is found within a different component of human cells: the mitochondria. It is not packaged into chromosomes but into a single ring of DNA.

Inheritance of DNA

In each case our DNA makes us unique. It is the ways in which the DNA varies from one individual to another and the ways in which it is passed down the generations that enable us to use DNA for genealogy research.

However, let’s not forget: human DNA is made up of around 3 billion base pairs and around 99.5% of those are the same in all of us – they are what makes us human. It’s only that 0.5% we are looking at when we talk about DNA testing in genealogy.

Which type of DNA test do you need?

We will talk about each type of testing in more detail in upcoming blog posts. In very general terms:

Y-DNA is passed from father to son and is unchanged for many generations. It can be useful for surname projects and looking at ancient origins.
mtDNA is passed from mother to all of her children (but is not passed on by her sons) and can be used to determine maternal ancestry, again unchanged for many generations. It is useful for identifying remains and looking at ancient origins.
X-DNA is passed from parent to child but a daughter will receive X-DNA from father and mother, a son will only receive X-DNA from his mother. It can be useful to place autosomal matches in a particular part of your family tree.
Autosomal DNA is passed from parent to child in varying combinations and can be used to assess close cousin relationships. It has mostly replaced Y-DNA and mtDNA for looking at living parent-child relationships now.

It’s easy to see why there is so much confusion about which test to take. Before deciding which test to take it is important to be clear in your mind what you are looking for, what is the question you want answered?

Next up

Subsequent blog posts cover each type of DNA test in detail. For ease of reference the links are here:

Demystifying DNA 2: Y-DNA tests

Demystifying DNA 3: mtDNA testing

Demystifying DNA 4: Autosomal DNA, Ancestry DNA and Family Finder tests

Remember

With all types of DNA testing, the DNA test is one source of information that can be used to aid genealogical research. You would not base a family tree on a single census record and in much the same way, DNA needs to be used in the context of known information and documentary research.

Upcoming Genealogy Events

Thu, 26 Sep 2024 19:57:00 GMT

Last year I blogged about missing the big face to face genealogy events, like RootsTech London, Who Do You Think You Are?, Family Tree Live! and The Genealogy Show. I missed being in a big room with a bunch of like-minded people! Thankfully, more and more events are happening in person again, after it seemed like everything was going to remain virtual only post the pandemic.

Recent Events

I've managed to get to a few now with my other hat on, running the Pharos Tutors stand, first at the Really Useful Show in St Ives in again, and then at the sister show Nottingham in June and it was so lovely to meet up with people "in real life" again and see some of our students in person for the first time. Another great day was the AGRA (Association of Genealogists and Researchers in Archives) AGM and Study Day in London.

Upcoming Events

There is a lot more happening now so I don't want to miss anyone out by attempting a comprehensive list. Here are some of the events in the next few months:

The Family History Show

5th October 2024

Kempton Park Racecourse

We'll be there with the Pharos Tutors stand so do come and say "hello". You can also get discounted tickets if you use this link: BUY TICKETS .

Doncaster & District FHS Family History Fair

12th October 2024

Doncaster

Suffolk Family History Society Fair

19th October 2024

Ipswich

Again, I'll be there with the Pharos Tutors stand, came and say "hi"!

Oxford Family History Society Fair

26th October 2024

Oxford

Where can I find more?

There are two really useful guides to upcoming events: Conference Keeper and GENEVA (GENealogical EVents and Activities):

Conference Keeper is run in the US. There are a LOT of US events but there are also now many UK and virtual events too, ranging from short talks to conferences: https://conferencekeeper.org

The second is a much older directory called GENEVA (GENealogical EVents and Activities). It is focussed on the UK and includes course from course and talk providers such as Pharos Tutors, the Society of Genealogists, the Guild of One-Name Studies but also includes a lot of the family history society events. As many of these are often held online, distance need no longer be an issue: http://geneva.weald.org.uk/doku.php?id=list

Consultation on Destruction of Wills

Fri, 02 Feb 2024 13:44:56 GMT

You may have seen in the press and on social media, reports of the consultation on wills. In summary, there is a Ministry of Justice (MoJ) proposal to digitise all original wills and, once that process is complete, destroy the original records. No one is questioning the importance of wills. They are not only important to family historians but to local historians, community historians and other historical researchers who may be using wills for a variety of reasons, including researching the language of wills, the handwriting, and even the writing materials used.

You can read the details of the consultation here: Storage and retention of original will documents .

The question here that needs to be addressed is: Does digitisation of an original record result in the digitised copy being a suitable replacement for the original?

The answer is of course a resounding ‘no’. How many of you have used digitised records before? Think about, for example, census records or parish registers. There are images missing, poor quality images, images where something, such as an added note, obscured part of a page but the page was not copied a second time without the note in the way. What about the reverse side of the pages? Sometimes there are important notes added that will not be copied if the plan is just to ‘make copies of the documents’.

Of course, those researchers looking at writing materials, inks and so on will need access to the originals regardless.

Longevity of technology is also an issue. Technology develops, is updated, replaced and becomes obsolete all the time. The MoJ consultation is motivated by ‘the very high cost of preserving the store of original paper wills and the supporting documents supplied in probate applications’ which it estimates at £4.5 million per annum. What of the cost of maintaining technology? More importantly, can they really guarantee no data will be lost each time technology is updated? No. The only way to ensure the set of records remains complete is to, well, keep the originals!

You can read a more detailed piece on this here: Destruction of Original Wills .

The consultation runs only through to the 23rd February 2024 . It is therefore important to have your say now!

How can you make a difference?

The most important thing you can do to make a difference is:

(1) Respond to the consultation yourself:
Storage and retention of original will documents

Will Storage consultation
Ministry of Justice
Civil Justice and Law Division,
Postpoint 5.25
102 Petty France
London
SW1H 9AJ

Email: civil_justice_poli@justice.gov.uk

(2) You should also consider signing the petition started by professional genealogist, Richard Holt:
Petition: do not allow original wills to be destroyed after 25 years

New Pharos Tutors Website

Mon, 12 Jun 2023 12:38:51 GMT

I am absolutely thrilled to announce that the website for my other business, Pharos Tutors , is now LIVE!

Pharos Tutors offers short online courses and certificate programmes in family history, local history and related topics. Today we have launched the brand new Pharos Tutors website and online course experience.

We have been working on this for a long time to get it right, and have now completely rebuilt all the Pharos Tutors systems to give an updated look, a more robust experience, and many, many improvements to better serve the current size of the business.

Key features include:

Updated look and feel
An easy to navigate website featuring the brand new Course Finder
Updated and modernised platform and technology
A single login for all Pharos Tutors systems – only one password to remember!
Technology used to run our courses brought ‘in house’ to run within the Pharos Tutors website
A totally redesigned Student interface, our Student Area, in keeping with a modern LMS (Learning Management System).

The new Pharos Tutors website has been developed as an intuitive system with simple navigation, providing a much enhanced visitor experience for both current students and those considering taking a course with us.

Why not take a look at the Course Finder to see what you might learn?

‘The Stranger in My Genes’ and other tales of unexpected DNA results

Sat, 27 May 2023 15:34:35 GMT

Those of you who follow me on social media will know that I’m an avid reader and have something of a book buying compulsion. Let’s just say the pile of books in the “to read” category far exceeds my available free time in the near future! Still, it is always better to “be prepared”…

It is, therefore, perhaps unsurprising that this is not a recent book release review. Published six years apart, The Stranger in My Genes , and its sequel, Strangers No More , are a pair of books that I purchased around a year ago and had been lamenting in that lonely “to read” pile ever since.

The Stranger in My Genes is a frank and honest account of Bill Griffeth’s discovery about his paternity from a DNA test, the impact it had upon him and the far reaching consequences, like ripples in a pond, across the wider family.

Whilst some people take a DNA test “for a bit of fun” Bill was already an avid family historian and talks of how his research had given him a real sense of identity, both with the people he had come to know and the places they had lived.

This is a compelling tale of the impact of suddenly finding out that your birth father isn’t who you thought they were, but, of course, it is not really a tale, it is a reality. Rather than jumping straight in with the DNA test and its consequences though this is a biography of the whole family. Bill’s older sisters and brother are just as important to the story as his parents and you are drawn into all of their stories, so much so, that by the end of the first book I was left wanting to know, “yes, but what about Barbara and Scharlene and Priscilla?” (Spoiler alert, we come back to them in Strangers No More ).

The Stranger in My Genes , published in 2016, begins with an email from Bill’s paternal cousin, Doug, who confirms the findings of Bill’s DNA test:

“My body responded before my brain could. I experienced a strange sensation of floating, and I could no longer feel the chair I was sitting in or the Blackberry I was holding…”

We are taken on Bill’s journey, reflecting on his childhood, the confirmation of the test results, testing others to be sure what the DNA results mean and his first awkward conversations with his mother. We learn that this is not the first family secret to be uncovered and the difficulties of no longer being connected to family stories that once were “yours”.

There’s a refreshing honesty about his response to the reactions of others and how words meant kindly are not always helpful, when you are still processing and coming to terms with what you have found.

The story continues in Strangers No More , published six years later. We learn more of the journey of discovery, more about the family and other uncovered secrets, but also about the many experiences of others who have been through something similar.

This is a genre that holds a special interest for me. I love helping people solve family mysteries with DNA results. There is always that feeling though, isn’t there?, that you can never really understand what it is to go through something like this unless you have experienced it yourself. I would encourage anyone working in this field to read both of these titles for the insights into what the reality feels like through the eyes of many who have been there.

More tales of unexpected DNA results and searches for unknown relatives

Like I said, this is a particular area of interest of mine. I have a fondness for reading accounts of unexpected findings from DNA results and of known adoptees searching for birth relatives. Here are some of the other titles I have read on a similar theme and that I would thoroughly recommend:

There is actually a great list I found too, predominantly aimed at adoptees: Adoptee Reading – Books about DNA Testing/Genetic Genealogy .

I’d love to hear your thoughts, whether on the books I have already read, those I have on my list or other titles you would recommended.

GRO Headstone Removal Records added to The Genealogist

Fri, 19 May 2023 14:28:49 GMT

The Genealogist website issued a press release today revealing the addition of 125,000 records to its headstone collection. These records are to be found in series RG 37 at The National Archives and relate to the removal of human remains and the associated headstones (not just headstones) and are a fascinating source of information.

You can access the collection by searching the “Deaths & Burials” section in Master Search and filtering down to “Headstones”. Here is an example of a Cowling record, located at St Paul, Chester Road, Hooton, Ellesmere Port, Cheshire. The entry includes links to images of the church and the churchyard, as well as a link to its location on Google Maps.

The press release is reproduced below:

The Genealogist has added to its Headstone Collection copies of records from certain local authorities and the Church Commissioners that relate to the removal of graves and tombstones in burial grounds. These records are held by The National Archives.

They detail former cemeteries from all over England and Wales and cover the years 1619 to 2003. A number contain a plan of the original place of burial while some will reveal the place of reinterment also.

Headstones are an extremely useful record for the family historian as they can give the researcher information that has not been recorded elsewhere.

They are mostly accurate in revealing dates and names and often other family members are on the same tombstone or are buried close by.

When a grave or headstone has been removed then a record of the inscription may have been recorded in this particular record set.

The "Removal of Graves and Tombstones" records on The Genealogist are part of their Death & Burials – Headstone Collection and are searchable by:

the deceased’s name
year of death
place of original burial
any keyword that may have been included

The origin of these RG 37 official records of burial ground removals can be traced back to 1911 and a recommendation was made by the Attorney General that such records be made and deposited with the local registrar of births and deaths. The Registrar General suggested to the Home Secretary of the time that the records should be deposited with the miscellaneous records held by the General Register Office instead of at the local registrar.

If your ancestor was buried in one of the burial grounds to have been recorded in this release then, despite the headstone no longer standing, you will be able to discover details about your ancestor recorded on their tombstone at the time it had been originally erected.

You can read the full article here: A not so final resting place , where you will also find a discount on a Diamond Subscription to The Genealogist.

Why I Started My Family Tree

Sun, 26 Mar 2023 10:53:50 GMT

People start researching their family for a number of reasons: a fascinating family story, an intriguing artefact, a bereavement, the birth of a new child. For me, it was my mother’s stories of the Hopkins family, starting from when I was very young. She didn’t know so much about her father’s side (the Jenkins) as her parents had divorced and she rarely saw her father, but she knew lots about the Hopkins, her mother’s side. It was photos like this that captured my attention:

So many members of the family in one image! My mum (Joyce Jenkins) is on the left, being made to giggle by her uncle Leo. In front of Leo (not Leonard) Joseph Hopkins (1914-1974) is his wife Florence, known to the family as Floss, née Phillips (1916-2006). My Grandma, Winifred May Jenkins née Hopkins (1910-1975) is in the centre. Then we have cheeky chappy, Barry Hopkins, son of Leo and Floss. Far right is Elizabeth (Lil) Mary Cecilia Hearn née Hopkins (1899-1975), who was the sister of Leo and Winifred.

The photo was likely taken around 1962-1964 and most likely in Erdington, near Birmingham, where the family lived for several generations. As you can imagine, even with this one photo I wanted to draw something on paper even if I didn’t know what a family tree was yet.

The older generation all died when I was quite small so I only have few memories of my Grandma. Many years later Mum took me to visit my Grandma’s grave for the first time (she didn’t feel able to go for many years and I was considered too young for the funeral).

My Grandma’s name hadn’t been added as there was no room, but her ashes are interred here. The last name is sister, Lil. Then it gets more interesting from a family history point of view. Joseph Bernard and Anne Hopkins were my great-grandparents and Joseph Hopkins was my great-great-grandfather. Suddenly I had lots of family tree information.

Sadly, we then fast forward to 2001, when my Mum died. We had her ashes interred at the Hopkins plot and I had the stone replaced to include my Grandma and Mum:

This was when I first started my family tree in a more formal way. I can still remember the first search I did on Ancestry and I signed up to GenesReunited in the hope of making contact with distant cousins. Imagine my surprise when I spotted my Uncle Rog, Mum’s brother, on GenesReunited. They say “great minds think alike” and by sheer chance he had also taken up an interest in researching the family tree. We shared lots of stories and he also pointed out there were other Hopkins buried at Erdington Abbey:

Joseph was my great-great grandfather, actually buried in the same plot as Mum’s ashes, and Isabel was his wife. Then the sad tale of children who died infancy. But there was more:

This last stone is more difficult to read from the photograph but is the grave of a couple, Joseph and Mary, the parents of Joseph, and my great x 3 grandparents.

That was it, I was hooked, and I haven’t looked back since.

What about you? Why did you start YOUR family tree?

MyHeritage Releases cM Explainer

Sun, 05 Mar 2023 15:01:12 GMT

The Announcement

RootsTech has just finished in Salt Lake City in the US and we were all excited to find out the latest innovations from the big companies. Personally, I’m always looking out for the DNA-related announcements. Some big news from My Heritage is the announcement of the release of its new DNA tool, cM Explainer™ .

The following comes from the press release [1]:

“cM Explainer™ [is] an innovative, free new feature that accurately estimates familial relationships between DNA Matches. For every DNA Match, cM Explainer™ offers a detailed prediction of the possible relationships between the two people and the respective probabilities of each relationship, determines their most recent common ancestor, and displays a diagram showing their relationship path. cM Explainer™ is fully integrated into the MyHeritage platform to shed light on any DNA Match found on MyHeritage, and is also available as a standalone tool to benefit consumers who have tested with other DNA services.

Other relationship prediction tools typically suggest a range of possible relationships that is too broad to be useful, such as “3rd to 5th cousin”, or list many relationships with the same probability, leaving the user confused. MyHeritage’s cM Explainer™ simplifies the predictions considerably and reduces ambiguity by taking into account the age of each match and assigning a unique probability to every relationship. MyHeritage further reduces confusion by avoiding ambiguous relationship terms used by other tools, such as “first cousin once removed” (sometimes written in excessively technical codes such as “1C1R”), and instead replaces them with clear relationships such as “parent’s first cousin” or “first cousin’s child”, as the case may be. For example, in a DNA Match where there are 1,600 cM of shared DNA between two people who are age 35 and 40, MyHeritage will tell the user simply that the match is most likely a half-sibling with 90.4% probability, whereas a popular alternative tool states a 100% probability for the match to have any of the following possible relationships: grandparent, aunt or uncle, half sibling, niece or nephew, or grandchild, leaving the user baffled. This makes MyHeritage’s cM Explainer™ the most useful tool for relationship prediction of DNA Matches on the market, for novices as well as experienced genetic genealogy professionals.

cM Explainer™ was developed by MyHeritage in collaboration with Larry Jones, developer of the cM Solver technology. MyHeritage exclusively licensed this technology from Jones, and the company’s science team enhanced it further over a period of five months. Among the enhancements are an age algorithm that more accurately pinpoints specific relationships and calculates their probability, and a slick user interface that displays possible relationships and their probabilities. cM Explainer™ includes useful features such as the ability to filter the predictions by full and half relationships, and to display the probable most recent common ancestor(s) (MRCA) of a match, making it a force multiplier for genetic genealogy.”

The Tool

That all sounds great, so let’s try it out. You can access the free standalone version here: cM Explainer™ . In the example below I have entered an amount of 212cM but left the age fields blank for now:

It is evident that the most likely relationship is second cousin, which far outweighs any other possibility. In fact this is the region of the amount shared by my father and his two brothers with a known second cousin. So far so good. What if I, the tester, am significantly older than my match. Let’s say I am in my 80s and my match is in their 30s so, we are likely about two generations apart. This changes things considerably:

Now it is far more likely that the match is the grandchild of my first cousin, so two generations younger than me as we might expect. We can click on the “show more possible relationships” option at the bottom of the screen to reveal more options.

You can see that the second cousin option is still there, it is just far less likely now that the ages of the testers have been taken into account. This makes perfect sense!

A nice additional feature is a view where you can see which are the most likely MRCAs from this data, with the option to show full and / or half relationships. The probability of any particular MRCA is the summation of the likely relationships that depend from it. For example the 55.1% probability of a grandparent MRCA comes from 45.6+9.5%.

These are the screens you will see if you use the standalone version of the tool (available to anyone, you don’t need a My Heritage account), but you will also find this technology embedded within your match lists if you have tested at My Heritage or uploaded DNA data there. “Estimated relationships” have now been replaced with “probable relationship” and you will also find this in shared match lists too.

You can read more about the cM Explainer here: Introducing cM Explainer™ to Predict Relationships Between DNA Matches With Greater Accuracy [2] or watch the Roots Tech presentation for free here: The Latest Research Tools to Assist with Your DNA Matches [3].

The Questions

As a detailed oriented person there are two obvious questions that come to mind for me:

How is this different from the Shared cM Tool (the widely accepted “gold standard”)?
What data is it based upon?

The announcement from MyHeritage tells us that the technology is based on Larry Jones’ cM Solver technology. It’s difficult to find out exactly how the cM Solver worked. I managed to find one YouTube video (here: Announcing the cM Solver tool! ) but there wasn’t a lot about the data on which it is based. The RootsTech presentation suggests the predicted relationships start with accepted calculations whereby the amount of shared DNA halves at each generation. The interesting bit is the correction for age algorithms. These started with Larry Jones’ work but the MyHeritage “ Science team enhanced it further over a period of five months…. Among the enhancements are an age algorithm developed by MyHeritage’s Science team that greatly enhances the prediction by adjusting the probability of each possible relationship ” [1, 2]. This included an evaluation of the range of age differences for each relationship found in the many real examples in customer family trees on the My Heritage website [3]. This sounds great as you no longer need to second guess how many likely generations there are between two individuals.

What about the Shared cM Tool?

The Shared cM Tool , created by Jonny Pearl, is based on two sets of data:

Over 60,000 examples of real data collected from volunteers who submitted the amounts of DNA shared with known relations, through the Shared cM Project run by Blaine Bettinger
Algorithms around probability, i.e. the likelihood of each relationship, from Leah Larkin, based on Ancestry’s white paper on matching and meiosis grouping (essentially based on the number of reproductive events).

You can read more detail on this here: Introducing the updated shared cM tool .

The shared cM Tool gives the following relationship possibilities for a match of 212cM (the same amount we looked at earlier):

Both the second cousin and first cousin twice removed (1C2R or cousin’s grandchild) relationships of MyHeritage’s cM Estimator appear in the most likely box, along with some other relationships. If we look at this in more detail in the Shared cM Tool:

What are we looking at? Well, for both of these relationships the amount of 212cM sits at around the highest point of the graph. In other words the most popular number of cM for a second cousin is around 212cM and the most popular number of cM for a half-GG-aunt is around 212cM, and in both cases around 50% of data falls in the “up to 212cM” range. So, looking at the two options either could be equally likely. What this doesn’t offer is a judgement of which if those is more likely, given a known age difference between two individuals, and you have make your own assessment based on your knowledge of the individuals concerned.

Which is “right”?

It is a little like comparing apples and pears. The calculations behind each tool are very different. Plus, the Shared cM tool uses real amounts of shared cM data, whereas the new MyHeritage cM estimator uses real data on the likely relationships for a particular age difference.

Remember, in any of these scenarios we are only pulling out the most likely relationship. You will still have to do the ground work to find the genealogical relationship. In both the Shared cM Tool and the new CM Estimator there are much less likely options than those discussed here already, e.g in the case of 212cM third cousin appears in both tables way down the list when you don’t take age into account. Someone has to be the one that fits that relationship. Always, the genealogical research is required.

My take aways

This is a great new tool. cM Estimator offers a very user friendly interface to find a small number of possible relationships between yourself and a match very quickly. The age estimator looks fantastic and it will be interesting to see what users report in terms of how it compares with proven known relationships for DNA matches. I will be working with both the cM Estimator and the Shared cM Tool now for sure.

Sources:

[1] MyHeritage Releases cM Explainer™ to Predict Familial Relationships Between DNA Matches with Greater Accuracy, press release received on 2nd March 2023.

[2] MyHeritage blog post, Introducing cM Explainer™ to Predict Relationships Between DNA Matches With Greater Accuracy.

[3] The Latest Research Tools to Assist with Your DNA Matches , presentation from Gal Zrihen at RootsTech 2023, sponsored by MyHeritage.

Y-DNA: New Tools from FamilyTreeDNA

Sun, 26 Feb 2023 16:06:11 GMT

Family Tree DNA (FTDNA) have recently released some fantastic new tools which are of great use to those of us using Y-DNA . Y-DNA is not the DNA you test at Ancestry, My Heritage etc (that’s autosomal DNA), it is the DNA that is passed relatively unchanged down the male line for many generations (see diagram below).

To keep this post to a manageable length, the remainder of this post jumps straight into the technical detail. If you would rather read an introduction to Y-DNA testing, see my earlier blog post on the subject: Demystifying DNA: Y-DNA tests.

One of the objectives when using Y-DNA is to try and identify how far back the common ancestor of two individuals lived: the TMRCA or Time to Most Recent Common Ancestor .

STR Y-DNA tests: new Time Predictor (TiP) Reports

If you have taken an STR Y-DNA test, such as the Y-111 test, you probably have looked at the “Time Predictor” or “TiP” reports (accessed via the icon highlighted below) to get an estimate of how two individuals are related.

Until now, the Time Predictor report presented data in the form of a table of number of generations and confidence interval percentages. So it might be only 61% likely that two men were related by a common ancestor born up to 4 generations back, but 95% likely they were related via a common ancestor born within the last 12 generations. What did this mean? If we say a generation is 25-30 years, the common ancestor was 95% likely to have been born sometime between now and as far back as 1663. It wasn’t the most ideal way to view the data because it was easy to get fixated on that number of 12 generations and ignore the range.

The Time Predictor functionality has had a complete revamp, both to the way in which data is now presented, making it far more user friendly, and to the algorithms used. The following example is of two of my Cowling project members, who match each other on their Y-111 tests with a genetic distance of 7. The match between them is highlighted in blue below:

We can see the common ancestor is likely to have been born around the year 1500, but there is a significant range, and this much more clear in these new reports. The common ancestor for this pair of testers could have been born anywhere between around 1200 and 1750. At the bottom of the report you will find wording to clarify this which tells us the two “are estimated to share a common paternal line ancestor who was, with a 95% probability, born between 1200 and 1750 CE. The most likely year is rounded to 1500 CE”. If you click on the area highlighted in blue above you can see the same information presented in a slight different way:

We can also see the affect that increasing genetic distance has on the estimates by clicking in the grey bottom section of the MRCA table (where you have “Show 0 to 10” etc):

It is clear to see that the greater the genetic distance the greater the range becomes and why, at higher genetic distances, the chance of finding a common ancestor within a genealogical relevant time frame (i.e. where documentary evidence exists) becomes less likely.

The previous TiP report was based on STR mutation rates and included a consideration of known different mutation rates of different STRs. So, depending on where you and an individual differed on the Y-DNA molecule, you might see two different MRCA estimates for two different matches that had both taken the same type of Y-DNA test and were the same genetic distance from you.

The new TiP report as shown above is the same for everyone, and is based on a huge amount of real data from those who have taken the Big-Y test, using Family Tree DNA’s new Age Estimates . In their words: “The millions of slow-mutating Y-SNP markers tested by Big Y together with the faster-mutating but fewer Y-STR markers give state-of-the-art estimates for the Time to Most Recent Common Ancestor (TMRCA) of each branch on the Y-DNA haplotree”. FTDNA then used this data to model most likely TMRCA ranges for each combination of number of Y-STR markers tested and genetic distance. Whilst the data is much improved it also corrects the reported error from users that the old predictions were too optimistic, i.e. they suggested a common ancestor in a more recent timeframe than the reality. So, try not to be disappointed if the new and improved data makes it look like your match is related further back in time than you originally thought!

You can read more about the new TiP reports here: Introducing the New FTDNATiP™ Report for Y-STRs .

Big Y DNA tests: Time Trees and Group Time Trees

The most detailed type of Y-DNA from Family Tree DNA is the Big-Y 700 test. Those who have taken this test are now able get a better estimate of how recently fellow Big-Y testers connect. We have had the “Block Tree” for a while, and we could estimate a TMRCA by counting the number of SNPs back to the common haplogroup. There were various estimates for this but there was a consensus that, for Big Y-700 data, an assumption of 83 years per SNP was suitable.

The Time Tree was released towards the end of last year, and uses the Age Estimates mentioned above to predict when a haplogroup was formed, i.e. when the MRCA was born. You can access this from the “Discover Haplogroup Reports” area of your Big Y dashboard, where your haplogroup, as calculated from your Big-Y test will be filled in for you.

A cut down example for haplogroup R-M2882 is shown below, which shows the MRCA for this individual’s haplogroup was likely born in around 900 BCE. Hmm, probably before the start of genealogical records then!

You can see there are three testers in the database with this haplogroup , two from the UK and one from Latvia. This is all very interesting but the latest release is even more exciting. Now we can look at all members of a FTDNA project together in Group Time Trees . There are different types of DNA projects: in my research I am most interested in a surname project but there are also projects based on places and haplogroups. You can see the diagram for my Cowling surname DNA project below:

Note that the R-M2882 group is included here and we can see that those two UK testers are members of my Cowling surname project, originating from Cambridgeshire and Huntingdonshire (neighbouring counties) based on research to date. There is also a pair of Yorkshire Cowlings with a more recent haplogroup, formed in around 1384 CE (range c.950-c.1700). The Cowling and Miller individuals are known close paternal relatives, so it is not surprising their haplogroup was formed more recently, in around 1900 CE, with a range from c.1750-c.1970. What does this mean for the Cowling project? We need more Y-DNA Big Y testers! The more people that test, the more new SNPs can be identified and the more haplogroups or branches can be added to the Y-DNA haplotree.

You can access the Group Time Tree for any project at the FamilyTreeDNA Discover page, but be sure to select “group project” to the left of the search box:

For more information about the Group Time Tree, see here: The Group Time Tree: A New Big Y Tool for FamilyTreeDNA Group Projects .

A plea from me

You can only see data in the Group Time Tree for individuals that have opted into sharing within a project. If you are a member of a project, please switch on sharing in the FamilyTreeDNA Account Settings to benefit others, using:

Group Projects -> Manage Group Projects -> Project Preferences -> Opt in to Sharing:

Lastly, if you are a COWLING and would be interested in joining the Cowling DNA project please get in touch via the Cowling DNA Project page .

Reflections on 2022

Sat, 31 Dec 2022 16:13:18 GMT

Not the smoothest start

Like many of you, I have had a mixed 2022. I started January on enforced bed rest following emergency surgery to repair a detached retina. Whilst the recovery took a lot longer than anticipated, I am happy to report that I am now much recovered. I will never get the full sight back in that eye but I am able to do everything I need to with glasses now, so I count my blessings it was operated on as quickly as it was (thanks to our marvellous NHS! ��).

Research and DNA

On the genealogical research front I was delighted to announce the launch of this new website in May, after a long period of development. I love my new logo with its three elements: research, DNA and teaching (that’s a map pin, indicating distance learning on the right, if you weren’t quite sure). This year I have been mostly working with cases that involve DNA. It is always important to say that DNA does not replace traditional genealogy research, the two are always used together. Many of my cases this year have been searches for birth fathers of older parents but it never seems to be simple. The Italians in Belfast and the Joneses of Manchester come immediately to mind. I have also been using DNA to add to the weight of evidence for relationships further back in time. These involve dogged determination and in that regard are no different to more traditional “brick wall” solving, but here there is a chance of something additional from a source where paper documents are not available. These are great fun (I do love a challenge!) and will continue into next year.

Teaching

Now to my other job, running Pharos Tutors® (you can find out about this more here at my other website: Pharos Tutors ). There has been lots of business development this year and both commissioning and writing new courses. One area I am particularly excited about is the ongoing development of the new Pharos website. Not only will the new website be more modern in feel and much easier to navigate, but all the “behind the scenes” technology is being upgraded too. A much more intuitive Student Area is coming with all course material grouped by course (a “must” for those dedicated students who take more than one course at a time – I don’t know how they do it!). The forum and chat rooms are also getting an upgrade and, as some of you will have seen already, some of our tutors are now running weekly tutorials using Zoom. My key learning from this year is that anything involving software development or website development takes way longer than you think (anyone who was waiting for the new Family Tree Maker or Roots Magic can testify to that). Partly this is my fault: I’m a persistent tweaker and want to bring you something “just right”. However, I also “blame” the development team as they keep coming up with great ideas we can add in too ��! So, I’m not going to commit to a time frame on that yet, just tell you that it will be most definitely worth the wait.

I also found out in the last couple of weeks that I have successfully attained my teaching qualification, a Postgraduate Certificate in Educational Practice.

A personal note

On a more personal note, as we progressed through the year we have also had some rather more serious family health issues to contend with. I know we are not alone in this. It has certainly lead to reprioritisation and more of a focus on a healthy work-life balance.

Looking forward

Looking forward to 2023 I am excited about having more time for genealogy research projects, both traditional and DNA research. There will also be the launch of the new Pharos website and there are some new courses in development, with some new tutors joining us shortly.

I will also be ensuring I take days off for spending time with family and friends, and have wellbeing days (an opportunity to get started on that massive reading pile) and focusing much more on that work-life balance.

What plans do you have for 2023?

I wish you all a healthy and happy 2023 and, for those who are currently struggling in any way, congratulations on surviving 2022, you made it.

HAPPY NEW YEAR to you all!

AI Time Machine from My Heritage

Sat, 19 Nov 2022 15:08:15 GMT

As you know, I take my genealogy research very seriously but sometimes it’s good to have “just a bit of fun” with it too. Many of you will have seen My Heritage’s tool, Deep Nostalgia , which was released in early 2021 and brought photos of loved ones “back to life”.

The latest tool from My Heritage, AI (Artificial Intelligence) Time Machine , is set to allow us to travel in time! If you are user of social media you will probably have seen people posting their results already. There have also been some reports about it in the press, such as this article from the Daily Mail .

Pictured is an example of my results for the “1970s Hippie” theme. To be honest, the “away with the fairies” look comes quite naturally to me!

You can access the tool here: Travel through history with the AI Time Machine . You do have to upload ten photos of yourself (so make sure you find those first) and ideally some should be side view and some full length, but you can still play around with it if you can’t find all of those.

At the time of writing there were over 20 different themes and examples (left to right) from the 1950s Chic, 1950s, Greek Goddess, Punk Rocker, 1940s, 1920s (B&W), 1970s Hippie and Saxon themes are shown below.

Heading Back to the Archives

Tue, 26 Oct 2021 15:14:30 GMT

It’s been a long time since I wrote a blog post. This fact is heavily connected to the fact that it has been a long time since I was able to carry out any “proper” genealogical research. You know the sort, where you actually venture into real archival repositories (instead of being constrained by covid to online research only).

Recently I was delighted to make a trip back to one of my favourite archives: Suffolk Archives at Bury St Edmunds. I mean what’s not to like? What more perfect route to “work” could there be than a walk through the Abbey Gardens, followed by a saunter past a graveyard:

It was something of a milestone moment: it was the trip to finish the research for a piece of work I had started at the end of 2019. I had already looked at the original documents I needed and I had used every index and transcription available but outstanding was some research in parish registers, “in the flesh”. OK, so that’s not actually how it works, Suffolk parish registers are only available to visitors on microfiche, for conservation reasons. They have been transcribed by the Suffolk Family History Society but, as any good researcher will tell you, ALWAYS check the original documents. So that was my goal, a list of parish registers to check against the transcriptions and a hunt for any further snippets of information.

Access to the microfiche has been the last to return for researchers at Suffolk Archives and is only recently available. I arrived on time for my two hours appointment at 10am. After a brief catch up with the lovely ladies (“Hello” to Sarah and Phil), time was limited after all, I sat myself at my microfiche reader, next to which had been placed the microfiche collections I needed and the lists of which registers were on which microfiche.

The whole experience was very organised, with covid precautions in place and no concerns or worries.

Opening times and access at archives around the country is still very varied and I would recommend carefully reading the latest opening updates on the relevant website before planning your visit.

For me, it was good to be back!

The popularity of family tree software

Tue, 16 Feb 2021 16:09:01 GMT

A week ago I posted a question on social media: “what’s your favourite family tree software?”

I’ve been updating some course notes this week for a course I'm about to teach. The course is on methodology and report writing and there are a few places where we look at what can (and can’t) be achieved with family tree software. Rather than leave things as they were, I decided I would like to use examples from software packages that more students were likely to use, and make sure I included a range. After all, there’s no point me taking screenshots from my own software if hardly anyone else uses it (spoiler alert: they don’t!). My gut feeling was that Family Tree Maker was still the most popular, given its connectivity with Ancestry, but I wanted to see what else scored highly. As so many people were kind enough to contribute their answers, I thought I would share the results.

I used Twitter and Facebook to run a couple of polls. Not a particularly scientific approach I know, but I was just looking to “get a feel” of what people use. Both Twitter and Facebook only enabled me to add a few possible answers to my poll. I then requested people add a comment with other options. What I don’t know is whether (a) anyone voted and then added a comment on the same software or (b) how many people voted on both Twitter and Facebook, but I think this gives us a general feel:

There were 400 responses so it is a reasonable set of data. Anything that had a vote of two or less was grouped together as “other”.

As we would expect, Family Tree Maker (FTM) is by far the most popular. There is no distinction between Windows and Mac users here, though FTM and Roots Magic can be used on either.

Roots Magic and Family Historian (Windows only) tied in second place and the most popular Mac-only software was Reunion.

What I did find interesting was the number of comments along the lines of “I use X for this and Y for that and occasionally use Z for this specific task”. I agree, I still haven’t found the “perfect” family tree software to store my own research and I’ve tried out many Windows and Mac programs where I’ve had a “nothing is working, let’s try this one” moment.

Oh, and if you are interested, my main programme is Reunion (I’m a Mac girl) but I dip into FTM from time to time, usually just to sync a tree to Ancestry. Will I be using Reunion screenshots through the course notes? No, of course not, but now I know to throw in some Roots Magic and Family Historian examples.

Would I personally use family tree software for a professional report? No. If you want to know more about how I would structure client reports you can find out more here: Advanced Methods and Reports .

Here’s to 2021

Thu, 31 Dec 2020 16:22:41 GMT

At this time of year I often look back and reflect upon the year just gone. Ordinarily I would have called this post “Looking back at 2020” but I think we all need to look forward to better times.

This year has seen me doing as much DNA related consulting as what is becoming more frequently referred to now as “traditional genealogy”. Next year I can foresee my research work being split around 50:50 between the two. I’m also planning a major overhaul of the Professional Family History website and there will be some tips on getting started with DNA.

The big change for me this year, however, occurred in June 2020 when I became the owner and Managing Director of Pharos Teaching and Tutoring Ltd. As a result, much of the year has been focused on the Pharos business and teaching. We’ve had some great feedback on our recent Student Survey and I’m looking forward to making some announcements about new tutors and courses in 2021.

From a personal perspective I’ve been so very lucky compared to others. My family, friends, colleagues and students have been relatively unscathed by the virus itself. It’s the impact of the virus on other things that I’ve seen the most this year. The saddest personal impact was that, when my two uncles died in April and May, we weren’t able to go to their funerals.

What I’ve seen the most has been the effects of covid on mental health, whether it’s been those with current issues getting worse, those who’ve not suffered for years having a revisit from anxiety and / or depression or those suffering for the first time. What has saddened me the most is the impact on young people. So many parents of teenagers I know have children who are suffering.

I can speak with experience as I have suffered mental health issues myself. I know this is said so often now it’s almost a cliché but it’s true: it’s OK to not be OK. Take a day off as a care day; take long walks, curl up with a book, whatever you need to do. That’s OK.

So what are the positives? For us, the lockdowns and periods of home schooling have enabled us to all spend more time together as a family and that’s had me reevaluating what’s important and what really is not.

A family history positive: Yesterday, looking for something different to do for a change, I dragged them out to a couple of local graveyards. Hey, it’s a great place for a little exercise and I guarantee you there won’t be crowds! ��

The photo below is the previously unseen by me grave of my 5 x great grandparents, John and Mary Goodchild, buried at Kedington, Suffolk.

So here’s to 2021 everyone. Let the end be in sight. Wishing you all peace, health and happiness.

Open for Family History Business

Wed, 17 Jun 2020 16:27:07 GMT

Some of you may have already seen the announcements from Pharos Teaching & Tutoring Ltd, a leading provider in online genealogy education. I have recently purchased the company from previous owner, Helen Osborn, and am now the new Managing Director. You can read the full announcement here: Pharos Tutors under new ownership .

What does this mean for my research business and clients? In reality not a huge amount at all. For the last few years I have been spending around half my time on research projects and half on tutoring whether for Pharos, for the IHGS or writing talks and presenting courses at the Society of Genealogists.

Right now I will need to dedicate a higher proportion of time to Pharos, but I also am booked up with current client research work. I won’t be taking on any new clients for a while, with the exception perhaps of a wee project or two, and I am fully booked until around this time next year now but that in itself is not that unusual.

So, it is very much business as usual at Professional Family History and I am going to enjoy combining research, DNA consultation and tutoring with my new role at Pharos.

Oh, and if you are interested in learning more about our courses, head over to Pharos Tutors now!

Karen

Accreditation and qualifications in professional genealogy

Mon, 04 May 2020 18:42:28 GMT

Seeing yet more tales of the “professional” genealogist who “took my money and I never heard from them again” on social media this week, made me think of a blog post I wrote back in 2014 on accreditation and professional qualifications in professional genealogy. Here is an updated version.

How do you choose a professional genealogist? One option is to ask for recommendations from others but that is not always possible. So, how else do you seek reassurance of quality?

If you are thinking of setting up as a professional genealogist how do you, as a newbie to the field, set yourself apart from all the others who are currently aspiring to do professional work?

In my view, there are two important areas consider here: accreditation and qualifications .

In the UK we do not yet have a formal accreditation process for genealogists giving the equivalent of the post nominal AG (accredited genealogist) those in the US may work towards. There are, however accrediting professional bodies:

Association of Genealogists and Researchers in Archives (AGRA) for England and Wales
Association of Scottish Genealogists and Researchers in Archives (ASGRA) for Scotland
Accredited Genealogists Ireland (AGI) for Ireland.

As an AGRA Member I am entitled to display the logo above on my website and other promotional material. AGRA is the only body for England and Wales that assesses the quality of client research, client correspondence and business acumen before granting membership. It is the safety net protecting would-be clients from those that “do not make the grade”. Of course, and let me clear on this, there are many excellent genealogists who are not members of AGRA but, in the absence of a word of mouth recommendation, looking for an AGRA Member provides assurance of a certain level of quality.

AGRA allows entry via a number of routes but the preference for qualifications in genealogy, is reflected in its membership application process. Less is required for those holding the following qualifications:

Pharos Tutors ' Advanced Certificate in Genealogy (in combination with the Society of Genealogists)
The Institute of Heraldic and Genealogical Studies (IHGS) Higher Certificate or higher qualification
University of Strathclyde ’s Postgraduate Certificate in Genealogical, Palaeographic and Heraldic Studies or a higher qualification
University Of Dundee ‘s Certificate in Family and Local History or higher (which must include the England module)

When I decided to move to a career in genealogy there was no dispensation for those with qualifications but I knew that I wanted to gain formal qualifications, partly to ensure I had a good grounding in the majority of sources I was likely to encounter, and partly to be able to offer potential clients a reassurance of my level of knowledge.

I can’t talk through the detail of all of the courses mentioned above but I have experience with Pharos and the IHGS. I have much experience of the Pharos Tutors courses, initially as a student, then as a tutor and, more recently as Course Director (EDIT: now Owner). I studied with the Institute of Heraldic and Genealogical Studies (IHGS) in Canterbury and have their Higher Certificate (distinction) and Diploma in Genealogy. I have also tutored their correspondence course that leads to the Higher Certificate.

The Register of Qualified Genealogists, though not an accreditation body, offers a list of members with certain qualifications that have chosen to be added to their register.

AGRA provides an (unbiased) comparison of the different courses available here .

Can you have one (accreditation or qualifications) without the other? I’ll leave the answer to that to you but here are some questions to think about:

You can still become a member of AGRA without having qualifications but how long will it take you to build sufficient experience to be working at that level?
You could gain a qualification and not become accredited but does just knowing about something mean you are good at working with clients?

If you are interested in more information about hiring a professional genealogist there is also some great advice from the Society of Genealogists here: Employing a Professional Genealogist .

If you are thinking about becoming a professional genealogist, see my Pharos Tutors course: Professional Genealogist – Become one, become a better one .

My grandmother: ahead of the times

Tue, 31 Dec 2019 12:27:34 GMT

As we come to the end of the holiday season and enter the New Year, many of us have spent time with family, or perhaps spent time thinking about family members no longer with us. As genealogists this can be the time we have opportunity to ask more questions about our family history. Here’s a story I uncovered about my Grandma, Joyce Young formerly Cowling.

A couple of months ago I was lucky enough to be handed a folder of family documents relating to my YOUNG and COWLING grandparents but it was the upcoming family gathering at Christmas, when I needed to return the folder, that spurred me on to look through and make copies of the documents contained.

This is how I remember my grandparents. Just like to many children: they were “just kind old people”.

My Grandma always used to say to me that she had been something of a “racey dresser” in her youth and I used to just look at her in disbelief I think. I vaguely remember a story about a swimsuit…

Amongst the folder of family treasures I found the following magazine clipping. It appeared in the edition of Woman magazine dated 23 October 1965.

So my Grandma had worn this swimsuit on the beach in Hythe in 1935? She would have been aged 17 years at the time. The original photograph was also in the folder:

Even more lovely was the letter that she had kept all these years:

She was even paid for the piece:

So, I think, less “old lady” and more “swimwear model”, wouldn’t you agree?

Introducing Pharos Tutors

Wed, 30 Oct 2019 15:02:17 GMT

This is a post I wrote when I was given the position of Course Director at Pharos Tutors back in October 2019. In June 2020 I bought the company.

I was absolutely delighted when I was recently appointed as Course Director for Pharos Tutors® (the middle “a” is pronounced like a for apple). However, it occurred to me that some of my international followers may not be familiar with the services Pharos provides. What follows is an introduction to Pharos for those who are not familiar with it and some of the background as to how the company arose for those that are. This post therefore has a promotional element but I hope you find it interesting too.

Pharos Tutors is a provider of online genealogy courses. It is based in the UK and therefore the focus of many (but not all) of the courses is UK and Ireland records. There are many standalone courses but two of the most popular offerings are the Family History Skills and Strategies certificate programmes: the Intermediate Certificate and Advanced Certificate , run in association with the Society of Genealogists in London . It is expected that students will have have experience with the fundamental records, such as birth, marriage and death records and parish registers, before enrolling on the Intermediate Certificate programme. Both certificate programmes consist of a range of subjects, taking the students from the more often used sources such as wills and probate records through to more challenging records, like manorial documents, and bringing in the broader study of the community. I’m summarising in the interests of space but see here for more information on the Pharos Certificate Courses . The Advanced Certificate is recognised by AGRA (the Association of Genealogists and Researchers in Archives) as a route to becoming a professional genealogist.

One of the big plus points of Pharos is its total flexibility. All courses, including those that are part of the certificate programmes, can be taken in isolation. We also have some specialised subject areas such as one name studies, DNA testing and how to become a professional genealogist.

The tutors are well known experts in their respective fields, many of whom have published books on their taught subject areas. I don’t want to list some tutors and miss others so see here for more information on the Pharos Tutors tutor team .

I have been tutoring and course writing for Pharos for five years but I decided to speak to Managing Director, Helen Osborn, to find out more about the origins of the company, which began in 2005.

What was the idea behind Pharos when you started the company?

There was no-one who was teaching family history online in the UK; everyone who wanted to learn had to travel to a face-to-face class or take an old-fashioned distance learning course at great expense. We wanted to bring short courses to everyone regardless of their ability or experience, and to bring enthusiasm and our experience as professional genealogists in not only finding people and breaking down brick walls, but also in adding that all important historical context which was lacking from many adult education classes in family history.

Who was on the original team?

Myself and Sherry Irvine were the founders and company owners; and we quickly recruited tutor Gill Blanchard, shortly followed by Liz Carter. Within a year we had a group of about 5 or 6.

Why the name “Pharos”?

We wanted something that stood out and had many discussions about what it should be called. Pharos is a lighthouse and we are all about shedding light on family history.

What was the very first Pharos course?

Now lost in time, I believe it might have been one of Gill’s which was a general course for England & Wales called “Planting the Tree”. Other early courses were “Scottish Research Online”, and “England and Wales Online”.

How have the courses changed over the last 14 years?

Almost all the courses have developed and changed, some have been more successful than others, some have been retired or totally re-written, but many of the courses that we have now have been running for a considerable amount of time.

What have been Pharos’ greatest successes?

Any course that gets good feedback is a success, and we have lots of wonderful feedback from students who have loved learning the Pharos way. Undoubtedly the joint certificate programmes we run together with the Society of Genealogists have been a huge success and particularly now the Advanced course is recognised by the Association of Genealogists and Researchers in Archives (AGRA). For me as tutor and author of many of the courses the high I get when a student has success with learning something new, maybe finding a long-lost ancestor, or developing their own projects and writing cannot be beaten. For me, that is the greatest success.

Review – Tracing Your Ancestors Using DNA

Tue, 29 Oct 2019 15:32:32 GMT

The most recent publication for those of interested in using DNA to assist with their family history research is the collaborative effort: Tracing Your Ancestors Using DNA , published in the summer. Edited by Graham S. Holton, this volume contains contributions from Graham himself plus John Cleary, Michelle Leonard, Ian McDonald and Alistair F. MacDonald.

The full chapter listing is as follows:

Why use DNA testing for genealogy?
The ethical and legal aspects of genetic genealogy
Understanding the principles of DNA testing for genealogy
atDNA tests
Y-DNA tests
mtDNA tests
Choosing between testing companies
Projects
An integrated approach to DNA testing for genealogy
Ancient DNA
What does the future hold?

A big plus for me is that, before even starting to talk about what DNA is or testing companies, this book takes us through why you might want to take a test and the ethical considerations you should first consider. With so many surprises found in DNA results and privacy issues to take into account, it is important to think things through in a balanced way before you start.

Then we have an introduction to DNA and individual chapters on the different types of DNA. These are comprehensive chapters and there is a lot of ground covered, perhaps overwhelming for a beginner on their first read. This is a book useful to both beginners and those who have some experience with DNA testing, so if it is all new to you, don’t be afraid of not understanding everything and needing to read these chapters again. Of particular note within the chapter on Autosomal DNA (e.g Ancestry DNA tests) is a really useful section on contacting matches and practical advice on working with matches.

My only gripe with these chapters, and this point is addressed to the publisher rather than the authors, is that DNA is far easier to understand with lots of colour pictures. The images are too small and who wants to try to understand a chromosome browser for the first time in shades of grey?

One of my favourite chapters, as it is an area of personal interest, was the chapter on projects. These are usually associated with Y-DNA but more and more are including autosomal DNA results. I was surprised, however, to find no mention of the Guild of One Name Studies, whose members run a number of the Y-DNA projects on Family Tree DNA.

Overall, an essential addition to the library for anyone serious about using DNA testing in family history research, that benefits from having contributions from some of the experts in the field on the different types of DNA. I would however, recommend that beginners read this in combination with Blaine Bettinger’s The Family Tree Guide to DNA Testing and Genetic Genealogy .

Review - Advanced Genetic Genealogy: Techniques and Case Studies

Mon, 01 Jul 2019 14:19:19 GMT

It’s been a while since I’ve published a book review but there are a couple of fantastic recent genetic genealogy publications that cannot go unrecognised. First up Advanced Genetic Genealogy: Techniques and Case Studies , edited by Debbie Parker Wayne.

The clue is in the title, this is most certainly not a book for beginners (you won’t find explanation of the types of DNA test or how to find your matches here). This is a veritable text book on genetic genealogy, not one to throw into your bag for the coffee shop but, oh my, what a fantastic read.

A collection of individual chapters / essays from some of the leading authors in the field, brought together by editor, Debbie Parker Wayne, you can either work through the chapters in order or dip in and out of the subjects that interest you the most. The opening paragraphs resonated with me: “Ask a question about using DNA for genealogical research in any online forum or on social media and dozens of immediate responses are received. Some of those responses will be from people with limited experience and expertise”. This book provides the “right” answers in a number of key areas.

The individual chapters cover a variety of topics, some are focused on techniques, others are case studies showing how DNA can be used successfully in combination with traditional research to solve complex problems. Some cover topics such as ethics and the future of genealogy. Authors include Debbie Parker Wayne, Blaine Bettinger and the UK’s own Debbie Kennett. The chapter listing is:

Lessons Learned from Triangulating a Genome (Jim Bartlett)
Visual Phasing Methodology and Techniques (Blaine T. Bettinger)
X-DNA Techniques and Limitations (Kathryn J. Johnston)
Y-DNA Analysis for a Family Study (James M. Owston)
Unknown and Misattributed Parentage Research (Melissa A. Johnson)
The Challenge of Endogamy and Pedigree Collapse (Kimberly T. Powell)
Parker Study: Combining atDNA & Y-DNA (Debbie Parker Wayne)
Would You Like Your Data Raw or Cooked? (Ann Turner)
Drowning in DNA? The Genealogical Proof Standard Tosses a Lifeline (Karen Stanbary)
Correlating Documentary and DNA Evidence to Identify an Unknown Ancestor (Patricia Lee Hobbs)
Writing about, Documenting, and Publishing DNA Test Results (Thomas W. Jones)
Ethical Underpinnings of Genetic Genealogy (Judy G. Russell)
Uncovering Family Secrets: The Human Side of DNA Testing (Michael D. Lacopo)
The Promise and Limitations of Genetic Genealogy (Debbie Kennett)

Being a total “data nerd” and needing the detail one of my favourites was “Would You Like Your Data Raw or Cooked?” from Ann Turner. “Visual Phasing Methodology and Techniques” from Blaine Bettinger was the reason I took so long to finish reading the book: I had to drop everything to start phasing DNA segments for my father and his two brothers right away! Not to be confused with chromosome painting, e.g. in DNA Painter, which many are familiar with as a way of visualising and analysing DNA segments in common with matches and another great technique, visual phasing is a somewhat different approach, drilling right down to where recombination events took place on each chromosome and assigning segments to all four grandparents. (You can of course then paint this in DNA Painter if you want to). I’m not there yet, I need some more close cousin matches, but it is powerful stuff.

Another excellent chapter from my perspective as a UK-based genealogist was Thomas W Jones’ “Writing about, Documenting, and Publishing DNA Test Results”. I am fascinated by methodology and documentation and, if anything, this chapter taught me I need to make some time to read Thomas’ others publications! This chapter also included some really useful advice on source citations when working with DNA data, such as the use of GEDMatch tools.

Whilst the bulk of the volume concentrates on technique, the last three chapters are a must read for anyone with any level of experience with DNA testing. Judy Russell’s chapter on ethical considerations had me muttering “damned right!” under my breath several times and Michael Lacopo’s commentary on his experiences with the one-way perception of privacy reflects my own observations.

Last up, was Debbie Kennett’s discussion on the promise and limitations of the different types of DNA testing and what we can hope to see in the future. As she concludes: “DNA has been a transformative tool for family history research, but we have so far only scratched the surface of its potential.”

All in all an excellent addition to the reference library of anyone serious about genetic genealogy. I guarantee you’ll need to read chapters more than once, as you can see from all my sticky notes in the image below:

Bringing Ancestors to Life: Photo Colourisation

Mon, 03 Jun 2019 13:16:10 GMT

Many of you will be looking forward to The Genealogy Show at the weekend in Birmingham. In recent weeks The Show ran a competition, giving the opportunity to win a colourised photograph of your ancestors. There were three categories: portrait, couple and group. Colourising photos is not something I’ve ever considered before. I suppose I have always been too much of a purist: “how do you know that those are the actual colours that were there?” However, Peter Jackson’s amazing Second World War film showed just how much colourisation can bring people to life.

I therefore decided to give it a go: This is the photograph of my grandparents, George Jenkins and Winifred Hopkins, that I submitted:

I was absolutely delighted when I won (I never win ANYTHING!). Here is the result:

The transformation is remarkable, wouldn’t you agree?

At about the time that I received the picture I noticed some talk on Twitter about apps you can use to colourise photos (with mixed quality results). I decided to find out more from colourisation artist, Claudia D’Souza, about the colourisation process when "done properly". This is what she told me:

“There is a huge difference between an app colourisation and a “hand” colourisation… [your photo took] at least 4 to 5 hours. The way it works is I paint over each shade using transparent colours and personally I blend with my fingers in between. I aim for a very natural look and also for the photo to still look it’s age, and not a reenactment . To achieve these different shades and different opacities are applied. Just the flesh will have a minimum of 5 different layers of colours again at different opacities the grayscale only tells you if it was a dark colour or a light colour. So unless the client tells me what the colours were, I will base the choice on research of the time and place the photo was taken and what was common at the time. Obviously that will never guarantee the colours are the real ones but they will be an historically accurate representation of what could have been. With military photos, it is different: there are vast records of uniform colours, also military records will often give the complexion, eye and hair colour of the person.

When I don’t know the eye, hair and complexion, I base it on their origin, descendants and physiognomy. The more detail and people a photo has, the longer it takes… I will not make the skin tone the same on 2 people because it will make the photo look fake. The apps are good to have a faint idea and their results vary a lot. A colour artist work is for special photos that you may want to display keep for future generations.”

I think that’s the important distinction. This is a keepsake for future generations. In fact, I decided that I liked the results so much I commissioned the same work on a wedding photo for my other set of grandparents: from this:

to this:

I’m sure you agree: the colourisation of these photographs really bring them to life.

If you want to have a photograph of your own colourised, visit Claudia’s website .

Family Treasures and a Great Honour

Sat, 23 Mar 2019 14:27:43 GMT

Most of the time when I start to write a blog post it’s based on an “oh, that’s interesting” moment. This post is different in that it’s entirely personal and I just wanted to share with those who will understand.

I travelled to my home town today to catch up with my Dad and see an uncle I haven’t seen in years. This uncle is the custodian of the family papers on the Young and Cowling side of my family and we agreed to meet at his house so that I could finally see the Cowling family Bible in person (I’ve been relying on some slightly out of focus photos all these years) and take some photographs of both the Bible and any other documents he could find. You, reader, will understand my excitement at this trip, not knowing what treasures were ahead.

What unfolded was a delightful day absorbing reminiscences of my father and his brother, looking through old photos I had never seen before and talking about their parents and grandparents “remember how they said Grandma was furious with them for spending over £1000 on a house!?”

But I didn’t get any photographs on my phone in the end. I’ve been handed the whole folder to take away and scan properly in my own time. I NEVER ask for this – I would much rather be allowed to see and take copies of anything than create suspicion I’m about to do a runner with the family treasures – so I feel honoured to have been trusted to take them away. There are old certificates I already have (but, again, poor copies) and all sorts of other bits and pieces, including a story for another time about my Grandma appearing on a beach in Hythe in a racy swimsuit 30 years ahead of her time.

What had me emotional, however, is this. I took no photos of the family Bible that began me on my Cowling family history journey. Names some of you will recognise from other blogs (and coursework case studies!). In a moment of ceremony my uncle presented me with the Cowling family Bible to keep as my own and pass on to future generations.

Words failed me.

How to Become a Professional Genealogist

Thu, 22 Nov 2018 17:25:41 GMT

Today is a day of celebration for me: eight years ago today I started up in business as a professional genealogist. This has been an incredible eight years, filled with the most amazing opportunities. I am now in the fortunate position of regularly being fully booked with genealogy research work, have spent time on the Association of Genealogists and Researchers in Archives (AGRA) Council and Board of Assessors, am a Tutor for both the Institute of Heraldic and Genealogical Studies (IHGS) and Pharos and run courses at the Society of Genealogists. I have also met some of the most amazing people and gained some fabulous friends. Do you know what else? I love this job! I’m often asked whether it as as much fun researching other people’s families as it is my own, YES! The “thrill of the chase” never goes away.

Are you thinking about starting up as a professional genealogist yourself? As it’s been 8 years for me here are my 8 top tips on how to be a (good) professional genealogist:

Be honest

Be honest with yourself about what you know and what you don’t. I guarantee you don’t know everything yet. Do you have enough knowledge and experience to begin working for others yet or do you need to learn more about genealogy sources first?

Be ethical

Don’t take on jobs that you don’t have the knowledge or experience for, stick with work that is focused on the simple sources to start with until you learn more. If you need to look at something new take time out in your own time to build your knowledge.

When you make suggestions for further work possibilities be honest, if there is only a slim chance you will find anything over a ten hour search, say so.

Be patient

You’ve printed off your business cards and your website has gone live. Surely now the queue of paying customers will begin to form? The harsh reality is no, it does take time and it takes longer than you think it might. Be patient and don’t give up!

Talk to others

Genealogists are a nice bunch of people! Get in touch and say “hi” to those in your area. Ask for advice. They may even offer you some work.

Take a course

We all have something to learn, a new case will still often bring something new for me, but do you need qualifications to be a professional genealogist? The long serving stalwart of genealogy will tell you “I’ve been doing this 25 years and I’ve never needed to go and get a qualification”, the qualified genealogist may tell you “how can you work as a professional without qualifications?”

In my opinion both are true: after all, there are many very good professional genealogists with no genealogy qualifications but lots and lots of experience on the job. There are also some genealogists with qualifications who may know a lot about genealogical sources but don’t have the skills to cut it doing professional work.

Let me ask you a question though: you decide to start up in business but you are not alone. There are more and more aspiring professional genealogists, after the surge of TV programmes like Who Do You Think You Are? and Heir Hunters . How do you stand apart from the rest? The best way is to be the best you can from the outset. Yes you can wait 25 years to gain all that experience but focussed learning will give you the much needed in depth knowledge more quickly as you work on real life cases and gain experience at the same time.

There’s some useful information on the formal courses available from AGRA, the Association of Genealogists and Researchers in Archives: Which course for genealogists?

If financial commitment is a worry, start small. There are shorter courses available from IHGS, Pharos, the SoG and Strathclyde University or you could begin with talks from your local Family History Society.

Aim for accreditation

This is a huge area of passion for me. Why? Working at the highest standards is all about providing the best possible service to your clients. How do clients know that the nicely polished family tree a “professional” has produced is not in fact riddled with errors? Organisations such as AGRA ( ASGRA in Scotland, AGI in Ireland) only grant full membership after assessment of examples of your professional work.

Much has been written on this recently by Paul Gorry, a professional genealogist and member of AGI, in his book Credentials for Genealogists . In fact this book has been causing something of a stir on social media, on both sides of the Atlantic. Should professional genealogists be accredited and what constitutes accreditation? It is the latter point that Paul has perhaps caused the most controversy with, blending factual information from many professional organisations and societies with forthright opinion. Not for the easily offended, I have to say I do agree with a lot of what’s in this book and its underlying messages: in order to protect our clients from the unscrupulous and the “just not ready” for professional work we must make efforts to rubber stamp our work.

Focus

It is easy to get distracted when working on your own research but you cannot do that when you are getting paid. Self-discipline and clear research plans are essential.

Giving it away for free

We do this job because we love it and it is so easy to go over the time we have been paid for to do a good job. I’ve been guilty of that myself. However, this is business and don’t forget: if you do twenty hours instead of the paid ten this time, your client will expect the same amount of work for the same money next time!

Taking it further

If you are interesting in becoming a professional genealogist and want to know more, the latest dates for my Pharos Professional Genealogist – Become One Become a Better Onecourse are now available HERE . This is a four week distance learning course and covers everything from starting up in business, setting rates and marketing to dealing with client commissions and report writing.

The Cowlings of Cambridgeshire

Tue, 06 Nov 2018 14:02:12 GMT

It has been a while since I have written about my own family history. I am lucky enough to conduct professional research in the archives where some of my own ancestors are recorded (if only there was more “spare” time!) and thought I would share some of the treasures I have found.

The photo below is my favourite family photo: the Cowling family. My Grandma, Joyce Cowling, is in the front row, second from the right. My great grandparents, Hubert John Cowling and Edith Dent are at the far left of the photo. The chap at the back with the magnificent moustache is my great grandfather, John Cowling.

Grandma and her two sisters were born in Birmingham but their father, Hubert, was from a long line of Cambridgeshire Cowlings. Hubert was born 30th April 1888 in Sawston, Cambridgeshire, the third of four children: Wilfred, Winifred, Hubert and Cyril. As well as tracing the family through online records such as certificates and census records, I have found a host of records at Cambridgeshire Archives and elsewhere.

For example, all four children are recorded in the Sawston school log books. Hubert arrived at the infant school on 16th February 1892 “ Have admitted two new pupils this week, Hubert Cowling & Bertie Woolley, both 4 yrs of age… ”. Wilfred and Cyril both gained scholarships to attend schools in Cambridge, Wilfred’s being to the prestigious Perse School. Winifred (pictured in the centre of the photo above) went on to become a teacher in Sawston. The infant school log book from 30th November 1900 reads “ Miss Barker leaves to-day… I have every hope that Winnie Cowling will in time turn out to be a useful teacher & I should be glad if she could be appointed as monitress in this school. ” Indeed, Winifred appears in the staff lists from 1900. The School Board Minutes from 5th November 1901 record “ … The Indentures of Miss E Wilson and Miss W Cowling were read over in their presence with their fathers and duly sealed by all. ” On 2nd November 1906 Winifred was recorded in the log books as “ absent… for the

day ” and on 17th November 1906 she left the school. It seems likely that she was absent to attend a job interview. Certainly by 1911 she was working as a teacher in Fenny Stratford, Buckinghamshire. Winifred later married and moved to The Midlands like her brother, Hubert.

The future for Hubert’s two brothers was not so bright. Wilfred died from pneumonia at only 16 years old. Cyril died in the First World War and is remembered on the Sawston War Memorial. My search for Cyril in a number of military records has been the subject of other blog posts .

Hubert’s father, John Cowling, was a compositor and the foreman in the printing office at Cramptons of Sawston and can be seen at work in his suit in the photograph below.

John was a man of standing in Sawston: the Cambridge Independent Press of 21st March 1913 reports that John Cowling was a member of the Parish Council who was re-elected at the AGM. John’s wife, Agnes, was probably the “Mrs Cowling” who came second place for her fern in the plant section in the Sawston Annual Show, reported in The Cambridge Independent Press, 8th August 1913.

However, John was not born in Sawston; he was born a few miles down the road in Ickleton, Cambridgeshire, the middle of five children of Daniel Cowling. John came from a number of generations of agricultural labourers and was the third generation of Cowlings to have been born in Ickleton.

The older generations of the Cowling family: Daniel (b. 1832), another John Cowling (b c.1804), and Sell Cowling (b. c.1775) all appear at various times in the Ickleton charity accounts, in receipt of “Chrisell Charity money”. This volume of accounts gives us lots of information. The very first payment found was in 1825 to “ Cell (sic) Cowling, 6 children “, confirming the number of surviving children by this time. John Cowling (b. c.1804)’s death can be traced through these accounts as his payment then went to his widow. Birth certificates for Daniel Cowling’s children indicate that he left Ickleton for Saffron Walden, Essex between November 1861 and August 1865. The charity accounts narrow this window to between September 1864 and August 1865.

The Cowling family can be traced back to Sell Cowling who was born in around 1775, but there the trail goes cold for now. Sell died in 1850, frustratingly the year before the 1851 census, and the 1841 census tells us only that he was born in Cambridgeshire. There is no baptism for him in the Cambridgeshire records. He may not have been baptised but I have a couple of hunches where there are gaps in the records. More research required! However, as the only evidence of Sell’s place of birth is essentially a single squiggle on the 1841 census, which could have been copied wrongly, my research is also taking me further out into the surrounding counties.

Do you have Cowlings in your family tree? If so I would love to hear from you.

Public or Private Family Tree? The results

Sun, 20 May 2018 14:02:15 GMT

A couple of weeks ago I posed the question “ Public or Private family tree? ” both here and on social media. I wasn’t intending to create a poll as such but so many have voted with their comments that I thought you would be interested in the results. The chart below is based on nearly 40 comments, both here on the blog and from Facebook and Twitter.

For those that voted “private”, the reasons included previous bad experiences, a fear of information being copied wrongly, and a lack of confidence in making the research public. My own experiences were reflected in the comments: “Many times I’ve had people take information from public trees, yet they would not reply to messages”.

Our next category are those who have “public” trees but solely for DNA matching purposes. This has become increasingly important, particularly on the Ancestry website where one aspect of matching known as “DNA Circles” requires a public family tree. Comments included “Now that I’ve done my DNA I want it public so I can make connections.” This is in fact what sparked my original post and why I am thinking of making the change from private to public.

There were also a number of “both” votes: a detailed tree kept private and a skeletal or ancestors only tree for either making connections or DNA matching.

By far the majority took the “public” vote, the most common reason being collaboration with others and making connections with distant relatives: “If you are wanting people to collaborate with you, you have to set an example and show a willingness to share”.

So, the majority have it. I am “going public” with my family tree for the first time in years. The perfectionist in me screams “but it’s not ready!”. There are many areas I haven’t looked at for years and there is much still to be added, but when is family history research ever “finished”?

I’ve moved my family tree into Family Tree Maker, I’ve pressed the “sync” button and, ah well, sync is down. I’ll try again later. Now that’s an opinion poll for another day…

Public or Private Family Tree?

Wed, 02 May 2018 16:37:57 GMT

I’ve found the opportunity recently to spend some time actually working on my own research and it’s led me to revisit the old debate: to have or not to have a public family tree?

Many of the websites offer the opportunity to upload or create a family tree. There are many reasons you may want to do this. Some use this service simply as a repository for their research.

Some use the “hints” or “matches” with record sets on the websites to expand their family tree. The most well known of these are the “shaking green leaves” on Ancestry. These come with their own inaccuracies and do not take away the need for thorough and proper research (a blog post in its own right).

Another reason you might want your family tree online is to share your research or provide the ability for others researching the same families as you to get in touch.

Most websites offer “private” or “public” versions for your family tree. A typical public tree entry in search results is shown below (tree owner information removed):

Some “private” trees let names appear in searches but require contact with you to get access to your full family tree:

What’s your preference?

When I first started out, long before thoughts of “going professional”, I happily uploaded everything I’d found to Ancestry in the hope of making contact with distant cousins (many other websites now offer this facility).

However, I look back and wonder at my naivety. I made contact with people, who confirmed a connection. In most cases we would share information and hopefully add to each other’s research. However, some people, who’d done very little for themselves, just helped themselves to everything I’d done! I still see examples of this now in others’ public family trees, the wording from our family Bible gives it away. I was most put out; it was me who’d spent hours on that research and me who’d spent lots of money on certificates proving things and it was just being taken. Was I wrong to feel hard done by? Was I not entering the spirit of sharing? What threw me the most was that my whole tree was being copied, not just the part related by blood to the individual of interest. Surely, that’s not quite right? Was I being too precious? Is family history not a collaborative affair? Should we not be thinking in terms of free and fair exchange of information?

For years since then I’ve only had the “partially private” option. I like to have something out there, so the names of my ancestors appear in searches, but I await contact before sharing any more detail.

I can’t talk about about online family trees without mentioning accuracy. Let’s be frank: there are a LOT of mistakes! I recently found the same couple, who were born in Cambridgeshire, originating from both Cornwall and Yorkshire, popping to Cambridgeshire to have one child and then returning to their place of origin to have the rest of their family. I’ve Birmingham family in the back to backs who apparently popped to the US to get married whilst having children in Brum. I’m sure you have similar tales. So then it occurred to me, wouldn’t it be better if all the “right” trees were public too, to increase the likelihood of it being the correct information that was copied from tree to tree to tree? Is that not what we should be doing?

The key to my recent dilemma however, is DNA testing. This is potentially fantastic tool for genealogist, but can only perform to its true potential with collaboration and sharing of data. So now I’m finding myself looking at DNA matches who, for whatever reason, have chosen to keep their tree private. The shoe is most definitely on the other foot now.

Do I go public?

What do you think?

Uncovering Illegitimacy: Who was Royce Brownjohn?

Fri, 23 Feb 2018 15:59:52 GMT

Clara Annie Jane Young was my first cousin three times removed (or my great grandfather’s first cousin). She was added to my family tree some time ago but I have only recently begun to research her family.

Clara married Joseph Henry Brownjohn in 1903 in Sparkhill, near Birmingham. By the time of the 1911 census the couple had moved to Leeds. An extract is shown below:

There were four children listed and yet the details of the children born to Clara tells us she only had three children. At first glance it looks as though there has been a mistake on the census return.

Thanks to the new BMD indexes available directly from the GRO we can now search birth indexes with a cross reference on mother’s maiden name before 1911. A search for Brownjohn births registered 1901-1911 with mother’s maiden name Young finds only:

So who was Royce Brownjohn? Another search of the GRO birth indexes finds:

The “-” in the new birth index indicates illegitimacy. On websites such as Ancestry you will find the mother’s maiden name is the same as the child’s name instead, but here the child was a Brownjohn and listed as illegitimate, so who’s son was he?

A copy of the PDF birth certificate from the GRO provides the answer:

Royce Brownjohn was the illegitimate son of Clara’s husband, Joseph Henry Brownjohn, and another lady, Dorothy Fern Harden. He was a typewriter salesman, she was a typist…

The rather unusual element of this certificate is that the father is named. From 1875 the father’s name could only be included on the birth registration if both mother and father signed as informants and more often you will find certificates with the mother named only. The fact that Joseph went to the birth registration indicates that he acknowledged the child as his own. It also explains why Royce was indexed in the GRO birth index as a Brownjohn even though he was illegitimate.

So let’s look back at the 1911 census. The relationship given is specifically to the head of the household rather than the couple, so it is correct: Christina, Cyril, Norman and Royce were all children of Joseph Henry Brownjohn. The line regarding marriage and children applies to the wife, so this is also correct: Clara married in 1903 and had three children: Christina, Cyril and Norman.

What is most fascinating though is this: take a look again at the name of the boarder living with the Brownjohn family, none other than Dorothy Fern Harden!

How do you research your family tree?

Thu, 15 Jun 2017 18:14:24 GMT

How do you research your family tree?

It’s not a trick question, I would like to know. There are so many adverts these days for the big commercial websites: “just type your name in and see what you will discover” and I am concerned we may be losing knowledge of how to conduct proper genealogical research.

It’s not a question of clicking links on Ancestry (other commercial websites are available) and adding people to your tree, or, even worse, basing research on shaking green leaves or hints. Yes, you can easily create a family tree this way but, and I say this with tongue in cheek, you could end up barking up completely the wrong tree!

There is far more to genealogical research: knowledge and methodology .

To conduct genealogical research effectively you need an understanding of sources. What sources should you investigate for a particular research need? When were they created and why? What is the likelihood that your ancestor will be included? There are many courses available to increase your knowledge of different sources, such as those from Pharos Tutors®, The Institute of Heraldic and Genealogical Studies (IHGS), and the Universities of Strathclyde and Dundee. There are also lots and lots of books available, e.g. the “ My Ancestor was… ” series from the Society of Genealogists and the “ Tracing Your … Ancestors ” series from Pen and Sword and many articles in the family history magazines.

Even with an understanding of sources there is still a need for caution with the data available on Ancestry, Find My Past and the like. What sources are actually included in a database? Is the database complete or will more records be added later? What are the most effective search techniques and how do you untangle the results you find?

I saw this posted on a social media group recently:

“ Which side do you work from and why? Family Tree Maker or Ancestry? ”

Argh! That had me positively jumping up and down on my soap box! Are we really led to believe that “everything is on Ancestry”? Is that what people think? Good quality research considers what sources are required THEN where they are, not the other way around .

This brings me onto methodology. In the UK we really do not give methodology much air time. Our US cousins are far better at formalising genealogy methodology. In my opinion we really need to think about this more.

Two things happened whilst I was at “WDYTYA Live” in Birmingham recently that left me with completely opposing opinions of “the way things are”. Firstly I went to a talk from American, Robert Charles Anderson, on the methodology he describes in his book Elements of Genealogical Analysis . It describes a systematic methodical approach to analysing your research and coming to sound conclusions. Some of you may be familiar with the Genealogical Proof Standard, more commonly used in the US but, again, a sound methodology to establishing “proof”. That deserves a series of blog post on its own so I won’t go into it further here. I thought Mr Anderson’s approach was excellent but around half the audience got up during the talk and walked out. Was it just the American records bias of the talk or are people really no longer interested in doing things properly?

At the complete opposite end of the scale, a new book had just been published by Pen and Sword from a colleague of mine, John Wintrip, Tracing Your Pre-Victorian Ancestors . The title is deceptive and really does not show it off to the best of the publisher’s abilities. Yes, there is much discussion on the specifics of research in the pre-Victorian period but it is the subtitle that is important: “ A Guide to Research Methods for Family Historians “. I understand that it was sold out by the end of day 2 at "WDYTYA Live", and I certainly did not see any copies for sale on the last day, so maybe we are still taking this seriously after all.

We need more of this in the UK: Sound advice on how to conduct proper, good quality genealogical research .

John starts by considering the skills and knowledge needed for genealogical research and breaks this down into four areas:

knowledge of sources
searching skills
analytical and problem solving skills
external knowledge

There are chapters on sources, distinguishing between original and derivative sources and records, and search techniques, including how to get the best from online databases.

Special consideration is given to names, social status, religion, occupations and migration and how these may affect your research journey but there is much focus on methodology: using archives, evidence and proof and techniques such as family reconstitution.

John’s book describes research techniques as used by the professionals and those who take their family history seriously. It introduces the concept of considering the records you are using in the context of what was happening from a historical perspective at the time. Filled with useful case studies from his own research John teaches you to consider the wider picture. Is it possible that a birth you may be looking for is not where you thought because the father was in the militia at the time and stationed elsewhere?

We do not have a lot of information about genealogy research methodology in the UK. The only other recent publication that comes to mind is the also excellent Genealogy: Essential Research Methods from Helen Osborn. Taking a slightly different approach to John Wintrip’s book I heartily recommend both volumes to anyone serious about their research.

Please, and I know I have used this word repeatedly, can we do this properly now?

Reading up on the ancestors

Mon, 20 Mar 2017 15:15:20 GMT

Over the last week I have been teaching students about the various routes to Continuing Professional Development in professional genealogy and it made me think about the increasing pile of books I’ve been accumulating, but still haven’t found time to read. Is it just me? I’m a self confessed book buying addict, if I don’t have a copy I need one. Perhaps it’s a genealogist thing.

I decided to take some time out and have some dedicated reading time. As this was a luxury in itself I went a step further and picked a couple of titles relevant to my own research! I was born in Sutton Coldfield near Birmingham, so many of my recent ancestors came from the Birmingham area. Ah, I have a book about that.

My maternal grandfather, George Hollings Jenkins, was born in Hunslet, Leeds in 1908. George is shown pictured centre in the photograph below, with his younger brothers Alfred (left) and Tom (right). Tom Jenkins was a violinist, famed for his position as leader of the BBC Palm Court Orchestra in the radio programme “Grand Hotel”. By the mid 1930s George had moved down to Birmingham.

It therefore made sense to focus on Tracing Your Birmingham Ancestors and Tracing Your Leeds Ancestors together and I thought I would share my views of these two titles with you*.

The Tracing Your… series is a popular series from publishers Pen and Sword. The difficulty with reading two books from the same publisher about tracing ancestors in cities is that you do notice more the similarities, a formula starts to shine through. However, there were some definite differences in style and content.

Tracing Your Birmingham Ancestors (Michael Sharpe)

This is a very well written and thoroughly enjoyable account of the unique nature of Birmingham and the surrounding areas, including Solihull and Sutton Coldfield (where I was born). Mike Sharpe describes the growth of Birmingham from its days as a rather insignificant parish compared to its neighbouring, more wealthy Aston, to the modern conurbation we see today. The complexity of changes in boundaries and jurisdictions is explained: “Where is Birmingham?” (answer “it depends”) and put into context with the search for genealogical records. The history of Birmingham is followed by a description of the major genealogical sources and where to find them. Rather than attempt to teach the basics of family history, not appropriate in a volume of this type, the descriptions are focused on the records available for Birmingham. Areas of focus include religion, trades, education, health, transport, crime and housing. I found the section on industry particularly interesting as a number of my ancestors were in the trades: brass workers, wire drawers, gunmakers and even a brass bedstead maker.

The major repositories in the Midlands area are described, references provided for the major classes of records and details given of many indexes and paper catalogues not available through the online catalogues. However, Mike doesn’t just focus on archives in Birmingham but also tells you where else to get access to Birmingham records. There are many references to specialist websites and museums and the BMSGH (Birmingham and Midland Society for Genealogy and Heraldry) and the Midlands Historical Data website feature repeatedly.

Thoroughly recommended for anyone with ancestors from Birmingham and the Midlands.

Tracing Your Leeds Ancestors (Rachel Bellerby)

A very specific title but useful to those, like myself, with ancestors from Leeds. Whilst the scope of the book is quite small an attempt is made to cover a vast array of material. There are excellent chapters on the history and development of the city and the rest of the book is broken down into themes, e.g. trades, education, poverty. Records and repositories relevant to Leeds are described in detail and information included about where to find different record types (not as straightforward as you might believe).

However, I wonder whether an attempt has not been made to cover too much in one volume. Whilst the majority of the book is written with Leeds specific research in mind there are some areas, e.g. Basic Resources, when an attempt is made to generalise and this is not always successful. The description of general family history resources is too brief and a referral to a general family history texts would have been better placed. House history, a significant subject in it own right, gets only a page and a half of coverage.

Overall though, well worth a read if you have ancestors from Leeds.

* Disclaimer: I was provided with a free copy of Tracing Your Leeds Ancestors in exchange for a review, though this was such a long time ago they may not even remember!

Research at the Norfolk-Cambridgeshire border

Mon, 09 Jan 2017 15:35:09 GMT

One of the parts of my job that I love the most is having the privilege to look at original historical documents. With more and more material becoming available online it can be a real treat to have the opportunity to examine documents in person.

I have recently been working on a very interesting case, for a client I’ve been working with for a number of years. During my last piece of work I spent almost as much time searching for what records survived and where they were held as I did examining documents. The family came from the Wisbech area in Cambridgeshire which, as you can see from the map below, is close to the borders with Lincolnshire and Norfolk.

My most recent work involved looking for two things: surviving poor law and associated records for Wisbech St Mary and parish registers, Bishop’s Transcripts and poor law records for the nearby parishes of West Walton, Walsoken and Emneth in Norfolk. You would think this would fairly straightforward, surely a combination of visits to Cambridgeshire Archives and Norfolk Record Office?

In fact it was far more complex than that. The parishes of interest all fall within the Deanery of Wisbech Lynn Marshland and the majority of records for these parishes are held at neither county archive but at the Wisbech and Fenland Museum.

Of course, only the majority of records are there. There are some poor law records for Wisbech St Mary at Cambridgeshire Archives and some at the Wisbech and Fenland Museum.

The parish registers for West Walton, Walsoken and Emneth are held at the Wisbech and Fenland Museum but Norfolk Record Office has microfiche copies.

The parishes West Walton, Walsoken and Emneth may all be in Norfolk but, whilst West Walton and Walsoken were under the jurisdiction of the Diocese of Norwich, Emneth was in the Diocese of Ely. Bishops Transcripts (BTs) for the Diocese of Norwich are are now easily accessed via the Family Search or Ancestry websites. To further complicate matters this part of the country also has Archdeacon’s Transcripts or Register Bills (RBs). These are also available on Family Search and Ancestry.

Cambridgeshire Archives is not the Diocesan Archive. The records of the Diocese of Ely are held within the Manuscripts Department at Cambridge University Library .

I now had a number of options. After extensive searching, emailing and telephone calls I established that the Wisbech St Mary poor law records for my period of interest were at Cambridgeshire Archives:

I examined my West Walton and Walsoken BTs and RBs online but travelled to Cambridgeshire University library to look at the BTs for Emneth, a rare opportunity to examine these original documents in person.

I then visited the Wisbech and Fenland Museum to examine parish registers and poor law records for my Norfolk parishes.

This particular piece of work may only have been looking at the more common sources for family history research but the location of the documents added its own level of complexity. This was a first visit to the Wisbech and Fenland Museum for me and a fantastic opportunity to look at a variety of documents. It is only a very small archive compared to others but the staff are exceedingly helpful and I really enjoyed visiting somewhere new.

Family Anecdotes of an Explosive Nature

Sun, 27 Mar 2016 14:12:04 GMT

The fundamental starting point when beginning to research your family history is to start with what you know. You hear it time and time again – dig out old documents and talk to family members. The trouble with talking to family members is, of course, where do you start? If you sit down Great Aunt Edith and say “tell me about the family” it’s going to be a short conversation. You need to be careful with how you word your questions to ensure you get the most information. Any family anecdotes add colour to your story and may include snippets of information that will later help progress your research. A student of mine told me other day that she’d been tracing one line for a while and stumbled upon the record of a potential family grave which had a huge impact on the direction research should take. When she questioned the family she was told they knew all about it but “didn’t think it was important”.

I’ve been questioning my poor Dad relentlessly since I became interested in family history and I thought I’d extracted all the humorous tales over the years. Until the other weekend when the sentence started “the day the policeman brought me home”! I’m sorry, what?

Pictured below is my Dad aged two. A sweet looking child I’m sure you’ll agree.

So my, until now crime-free, Dad was messing about with some friends near an old hollow tree when the local Bobby walked by. Suspicion aroused by their cagey behaviour he approached them to ask them what they were up to and stuck his head into the tree for a closer look just as the bangers they’d thrown in exploded! Dad was understandably walked home so the policeman could have a word with his parents. This was the 1950s and the front door wasn’t often used. Dad automatically took the policeman around the back of the house where he was given a friendly greeting by the family Alsatian. The policeman, or in the dog’s eyes, the "intruder" didn’t fare so well and my Dad left him pinned against the garden wall whilst he went to fetch my Grandma.

Unfortunately it appears that playing with explosives runs in the family. During the Second World War Birmingham was hit a number of times by incendiary bombs. On one of these raids my great grandfather secured an unexploded incendiary bomb as a “souvenir”. I know what you’re thinking, and he wasn’t daft. A mechanic by trade, he carefully unwound the end of the bomb containing the explosive and removed the explosive, thus making it safe. He then proceeded to engrave the date on the side of the bomb casing for posterity and it was hung above the fireplace. Years later after my great grandparents had died and my grandparents had inherited the souvenir, some remodelling was ongoing and my Grandma wanted rid of it. She is quoted as saying to my Grandad “you can’t put a bomb in the bin!” So he decided the best thing to do was build a nice big bonfire, get it nice and hot and melt it. At the time my Dad and his friends (let’s just call them the “hooligans” now shall we?) were playing out on an area behind the bottom of the garden. They heard the massive explosion and ran to see what had happened just in time to see my Grandad crawling back out of the hedge on the other side of the garden that the blast had thrown him into. So apparently there was also a small explosive charge in an incendiary bomb, the device that had hung over the family fireplace for years. I believe the local constable made a visit that day too.

Remember to keep questioning your relatives, you never know what you’ll uncover!

Review - Missing But Not Forgotten, Men of the Thiepval Memorial

Sun, 01 Nov 2015 19:19:21 GMT

Regular readers of this blog will remember the story of my great x 2 uncle, Cyril Frank Cowling (1892-1916) . Cyril enlisted in London with the 1st/15th Prince of Wales Own Civil Service Rifles, part of the London Regiment, with a group of friends in around June 1915. He died on 15th September 1916 in the “Battle of Flers-Courcelette” at High Wood during the Battle of the Somme. He is remembered at the Thiepval Memorial.

The Thiepval Memorial commemorates over 72,000 men from the British and South African regiments and corps who lost their lives on the Somme Front between July 1915 and March 1918 and have no known grave. Of those over 90% fell during the Battle of the Somme between July and November 1916. Most of those remembered were in the Army but there are also those from the Royal Navy, Royal Marines and Royal Naval Volunteer Reserve.

I was recently given the opportunity* to review a new release from Pen and Sword books, Missing But Not Forgotten – Men of the Thiepval Memorial Somme , from Pam and Ken Linge.

The book represents part of a huge undertaking by the authors to provide the stories of all the missing men commemorated at Thiepval and provide them with a fitting memorial. It does not aim to provide the history of the First World War at the Somme but, rather, provides the personal stories of a sample of the men who fell. To avoid the volume becoming unwieldy only 200 of the over 72,000 biographies are included. It is must have been almost impossible to decide which individuals to include but an attempt has been made to include examples from each battalion and regiment represented at Thiepval.

What is demonstrated is the range of social backgrounds, educational levels and ranks of those who were killed at the Somme. George Leonard Jenkins, a Private in the East Surrey Regiment, was the son of a manager to a metal merchant. Alexander Young, a Lieutenant in the South African Infantry, was educated at Model School, Galway and was awarded the Victoria Cross for services during Boer War. Claude Theodore Church, a Sergeant in the Norfolk Regiment was a footman serving in the Royal Mews at Buckingham Palace.

The biographical entries for each serviceman contain details of parents, wives, siblings, extracts from letters home and extracts from the letters sent to grieving parents and wives by superior officers and comrades notifying them that their loved one was missing or dead. There are comments about the individual’s disposition “always so cheery”, “I considered him a friend” and so on that bring to life the faceless names on the memorial. There are many tales of a number of brothers who died within a short time of one another. One particularly poignant story is the entry for Frederick William Bennett and his friend William Bentley. Both lived in Burton Street in Tutbury near Burton-on-Trent and worked at the local Nestle’s Condensary. They enlisted together and served in Gallipoli, Egypt and France. On 30th September 1916 they were both killed by the same shell in fighting near Thiepval.

My relative, Cyril Frank Cowling, is unfortunately not one of the ones included in the book. There is, however, a biography of one of Cyril’s battalion, Charles Bertram Stalley, Private 2812 of the 1st/15th. Like Cyril, Charles died on 15th September 1916 at High Wood. Charles was one of at least six children of Alfred and Sarah Stalley (formerly Hardy) of Romford, Essex. Charles worked for the Great Eastern Railway and whilst he was on active service some of his letters and sketches were published in the staff magazine. Part of one of these, published in the book, is reproduced below:

I’ve seen a few ruined towns but none to equal this – its desolation struck me more forcibly than ever. Picture those marches to the trenches… We do not look like the smart soldiers you see at home. We move off in fours, and as we approach the fighting zone drop to two deep, later to single file. No smoking, no talking. By the time we approach the trenches we are fatigued….

In summary the book provides a fitting memorial to a number of those who fell at the Somme and even where an individual is not included it is possible to gain from the stories of those in the same battalion and regiment.

The Centenary of the Battle of the Somme commemoration will take place at the Thiepval memorial on 1st July 2016. Tickets are available by ballot until 18th November 2015.

* Disclaimer: I was provided with a free copy of the book in exchange for providing a review.

More Bigamist Antics Using Offline Records

Tue, 18 Aug 2015 18:41:18 GMT

Henry Thomas Dent was the subject of my last blog post, My Bigamist Black Sheep . An uncle of my paternal grandmother, family members remembered him to have been a bigamist with one wife in England and another in Australia!

Using online records I had found that Henry was tried at the Sydney Quarter Sessions in December 1924 on a charge of bigamy. He had married a Lillian Kate Mant in 1919 in Paddington, London but on 30th April 1921 Henry married an Elsie Victoria Usher at Annandale, New South Wales “the said Lillian Kate Mant being then alive”. Henry was sentenced to six months hard labour. Initial searches of indexes at New South Wales archives in Australia had not found any additional information.

Since that time I am very excited to report that, with the assistance of a genealogist in Australia, I have been able to access the court papers for the case in question and a gaol entry book entry including a photograph of Henry, over 50 pages of information! Included in the case papers was another photograph of Henry, his marriage certificate to Elsie, letters from Henry to Lilian and depositions from Lilian, Elsie, and Elsie’s father, Joseph Usher.

The documents reveal that Henry had first arrived in Australia in 1911. He had met Elsie in around 1912 in Mount Victoria and therefore knew her before he married Lilian Mant. He joined the AIF (Australian Imperial Force) in 1914 and was in correspondence with Elsie whilst he was away on active service during the First World War.

Henry had previously been in Children’s Court in Sydney in September 1924 for refusing to pay Lilian Mant maintenance for their child in England. It was at this time he was accused of also being married to Elsie Usher, his response to which was “yes but I don’t want her to know anything about it”. In fact when a warrant was issued for his arrest on the bigamy charge in October 1924 Henry was quoted as saying “I thought they had forgotten all about it”. Was Henry a little naive or a bit of a chancer?

The examination of Lilian reveals that Henry returned to Australia in 1920 to be demobilised from the army. He had told his wife he would return to England as soon as he received his discharge. The image above is the first page of a letter Henry wrote to Lilian in July 1920, only a month before their daughter was born. As you can see it begins “My Darling Wife”. It is full of terms of care and affection and is signed off “I remain your Affectionate Hubby, Harry XXX”. Lovely for me is the fact that “Biddy” was the pet name for my grandmother and Doris was her sister. However, the letter does reveal that Henry had already got a job working as a carpenter at the “Hotel Australia” so perhaps he had already decided to stay in Australia.

On 25th April 1921 Lilian, determined to be reunited with her husband, purchased her passage to Australia and was due to sail in around July 1921. The date of the purchase was a mere five days before Henry married Elsie Usher! Unsurprisingly, Henry cabled Lilian telling her not to come, with promises that he would soon be home.

The last letter Henry sent to Lilian is transcribed in full below:

“12 Dec 1921

Box 13 Oxford St

My Dear Kiddie

I hardly know how to write to you after so long an absence. Well, I sent you a Cable today, saying that I would write explaining but now that I come to do it on paper I hardly know what to say.

Well I am extremely sorry that I have kept you so long without any news but I have had to keep quiet for a purpose & now that everything is OK I will do my best towards you, so if you are still willing to come out here I will arrange a passage for you on this side or you can do it over there, just as you like, I know it takes a long time but I hope everything will be alright.

I met my old Pal on Saturday Mr Pickard & he told me you had wrote to him & I was rather surprised but still, I suppose you did not know what to do.

Well I must draw to a close as I was to catch the Mail so trusting it will not be long before we meet & settle down, & that you are keeping well, so with best love & kisses to you & Babs

I remain

Your Loving Husband

Harry xxx

PS It is not much use putting on the address where I am living as I might be leaving there after Xmas.”

The lack of a return address is telling and the tone of the letter very different from the previous one even if Henry did end with “I remain Your Loving Husband”. The phrase “I have had to keep quiet for a purpose” I find particularly intriguing. Did Henry know his days of “getting away with it” were numbered?

Over in Australia Henry’s second wife, Elsie, declared on examination that “since going through the form of marriage with him I have lived happily with him” and her father, Joseph, stated “he has always been a well behaved man”. In fact when Henry had served his gaol time he returned to Elsie, and they had two children.

Did Henry know Lilian before he met Elsie? Was Elsie a particularly forgiving woman or had she been his first love from when they met in 1911? Of course we can’t know for sure but the romantic in me would prefer it to be the latter.

The key point here is that there is so much information that is NOT available online. Don’t stop there. If you can’t visit an archive in person to carry on digging use a researcher local to the area. Who knows? You may end up with a treasure trove like this one.

My Bigamist Black Sheep

Sun, 03 May 2015 18:33:10 GMT

I recently took a break from my usual family history research in Cambridgeshire, Essex and Suffolk and investigated a family tale of my own – the black sheep of the family.

Much of my own family history research has focused on my four grandparents and I have had little opportunity to investigate the family of my great grandmother, Edith Lilian Cowling formerly Dent.

Looking back through some old emails recently I found the tale of Edith’s brother, Tom, who allegedly was a bigamist and ran off to Australia never to be spoken of again. Now quite often with family stories like these there has been some embellishment over the years and the reality is far less exciting. However, I couldn’t resist the urge to do a little digging.

Henry Thomas (Tom) Dent was born in Woodford, Essex in 1886, the son of Henry Dent, a gardener, and Minnie Dent formerly Riches. In 1919 he married Kate Lilian Mant, the daughter of a railway guard, in Paddington, London and in August 1920 they had a daughter, Marjorie Edith Dent. It all sounds good so far, yes?

Then the fun begins. I was having a play on Ancestry and typed in “Henry Thomas Dent” into the Australian records collection. The first result that caught my eye was a couple of entries in the NSW Police Gazette. Ah…

Henry Thomas Dent was tried at the Sydney Quarter Sessions in December 1924 for, you’ve guessed it, a charge of bigamy. The documents include Henry’s marriage to Lillian Kate Mant in 1919 in Paddington but reveal that on 30th April 1921 Henry married an Elsie Victoria Usher at Annandale, New South Wales “the said Lillian Kate Mant being then alive”. Henry was sentenced to six months hard labour. The entry on the Police Gazette relating to Henry’s discharge described him as 5ft 7.5in with fair complexion and brown hair. He was also recorded as having a long nose and a large mouth!

Also included in the Police Gazette records was a reference to a photo book. As I have no photos of Henry, this had me very excited. Many of these photo books have recently been made available online at Find May Past and more information may be found here: New South Wales Gaol Photographic Description Books 1871-1969 . Unfortunately, the book of interest here is not included in this collection and consultation with an Australian genealogist revealed that this book does not appear to have survived. Frustratingly, the same researcher found that Henry was not included in the surviving Quarter Sessions Index or Gaol Entry books.

However, more information was to be found in the newspaper reports for the trial amongst the marvellous collection at The National Library of Australia’s Trove website . Two of my favourite articles are transcribed below:

First in the Evening News (Sydney) dated Thursday 6 November 1924:

BIGAMY CHARGE

‘MUST HAVE BEEN MAD’

HENRY Thomas Dent, 38, carpenter, was committed for trial at Paddington Court to-day on a charge of bigamy. It was alleged that Dent was married at Paddington, England, in November, 1919, and on April 30, 1921, went through the marriage ceremony with another woman at Annandale. When arrested Dent, it was alleged, admitted that he knew his wife was alive when the second ceremony took place. ‘I don’t know, why I did It,’ he was said to have added. ‘I must have been mad’.

and secondly, in the Evening News (Sidney) dated Wednesday 10 December 1924:

HIS TWO WIVES

ONE IN ENGLAND

MAN’S PREDICAMENT

Ignoring a promise to go back to his wife in England as soon as he had fixed up his affairs in Australia Henry Thomas Dent, 38, carpenter went through the ceremony of marriage with a woman he had known before the war, according to evidence at Darlinghurst Sessions today. Dent pleaded guilty to a charge of bigamy. Mr J W Abigail, for accused, said he had served over five years in the AIF. Acting-Judge Rowland: He was in the provost corps. It was stated that Dent married Lillian Kate Mant in London, in November 1919. There was one child of the marriage. He did not tell his second wife of his marriage in England. He had known her for 12 years and she had corresponded with him all the time he was abroad.

WIFE’S STORY

According to the wife’s statement, Dent had not only failed to keep his promise to return, but he had prevented her coming to Australia. She had paid £23 for a steamer passage, but she had cancelled it on receiving a cable from Dent to the effect that he was leaving for England. However, he did not come. In 1920 he sent her £200, but she had received nothing from then until the end of 1922, when he commenced payments of £2 about every three months. Mr J W Abigail said that Dent had asked his wife to come to Australia but she said she would not leave her aged mother. Dent was remanded for sentence.

This family story of the black sheep of the family turned out out to be true. I particularly like the quote from Henry ‘ I don’t know, why I did It, I must have been mad ’…

How to Choose a Professional Genealogist

Thu, 16 Apr 2015 17:48:17 GMT

Today is an exciting day for family historians in the UK. The first day of “WDYTYA Live!”, the largest genealogy symposium we have. Many family historians are heading to Birmingham today, perhaps wanting to find answers to their questions in the “Ask the Experts” area, perhaps wanting to visit the many stands or perhaps mostly wanting to catch up with like minded people. Many “professionals” will also be there but if you want to hire a professional, what should you look for?

There are now many websites offering genealogical services on the internet. If you search for “ professional genealogist ” or “ family history researcher ” in the search engines such as Google you will find many pages of results.

So how do you know who are the “good” ones? You may wonder why I have decided to provide guidance here. Surely I should be encouraging you to employ this genealogist? As with any profession, not all so-called “professionals” are as good as others and it concerns me that members of the public are parting with their hard-earned funds for services that are simply not up to scratch. I have had copies of reports sent to me described as “research conducted by the previous professional” that were so lacking in detail that I have had to repeat some of the work to ensure certain records had been checked.

Many websites and advertisements include claims regarding experience and qualifications but beware of “embellishment”. The researcher that has 20 years experience may have started working on their own family tree 20 years ago but have actually only been in business using the wide range of records necessary for professional work for the last 2 years.

So what should you look for when choosing a researcher in the UK?

Sometimes instinct is sufficient to weed out those who offer a below par service. If you make an enquiry and receive a written reply full of grammatical errors, you can be fairly certain that your final report will be similar. Genealogists who make generic promises are also to be avoided. If you see “I guarantee to research your family back to the 1700s” ask yourself “How?”. The ability to progress research depends on record survival, legibility of records, lack of transcription errors in indexes and the truthfulness of our ancestors, to name but a few.

Some qualifications are readily checked, others less so. For example if you wanted to check I have actually been awarded the Diploma in Genealogy you can consult the IHGS Graduate list .

In terms of reporting you should expect to receive a professionally written report that includes details of the records searched and the dates ranges considered. If records have been consulted but no record of your family found then these searches should also be included in the report to prevent you wasting money having the same records searched at later date. A good genealogist will write a report in such a way that it can be used to form the basis of future research. “I looked at the 1891 census but could not find him” gives you limited information. “I searched the 1891 census indexes on both Ancestry and Find My Past for John Hopkin, Hopkins, Hipkin or Hipkins born 1832-1834 in Worcestershire and no results were found” gives a far better indication on where to start future searches. Sources are particularly important. In advice from the Society of Genealogists (see below) the following is noted: Citations within the report should enable anyone to find and recreate the genealogy from the sources used and allow the reader to follow the reasoning leading towards any conclusions .

Two examples of a source for a parish register search are:

Parish registers for Barking, Suffolk
Barking, Suffolk composite register (original images on microfiche) covering baptisms 1692-1728; marriages 1692-1728 and burials 1692-1728 (reference: FB15/D1/2), fiche 6-7 of 34, examined at Suffolk Record Office, Ipswich on 21 Oct 2013

The second includes the format in which a record was searched (microfiche copies can be harder to read than the original), where and when it was examined and a full reference. Another researcher could readily go to Ipswich and find the same reference.

In my opinion there are two ways to find a good quality researcher in the UK:

a recommendation from a friend or colleague who has experience of the quality of a researcher’s work
employing an accredited genealogist

In England and Wales the ONLY body who assesses the quality of a researcher’s work and their business approach before granting full membership is The Association of Genealogists and Researchers in Archives (AGRA). The accreditation “AGRA Member” indicates a member who has been through this process. Both full “Members” and not yet fully assessed “Associates” have agreed to be bound by AGRA’s Code of Practice. ASGRA in Scotland and APGI in Ireland perform similar functions. The AGRA Website may be used to find researchers with the specialism you require.

An alternative to AGRA, used by some UK researchers, is the US-based Association of Professional Genealogists (APG) , though it should be noted that, whilst members agree to abide by a Code of Ethics, no assessment of research is made before APG membership is granted. The US have their own schemes for accreditation.

Good advice is also available from AGRA and the Society of Genealogists .

Both AGRA and APG have stands at WDYTYA Live! If you want to know more, pop along and speak to them face to face.

Manorial Documents Register

Thu, 18 Dec 2014 12:14:20 GMT

With the recent release of the online index to the Manorial Document Register for Suffolk it seems timely to write a piece on manorial documents.

Manorial documents are often overlooked when conducting genealogical research. However, they can contain a wealth of information about your ancestors, whether they were involved in land transactions, had committed offences or were listed as members of the jury. They are also invaluable when researching the history of a property, recording the transfer of property often over multiple generations.

When William I arrived in 1066 and took possession of England, all land belonged to the monarch. The term real estate comes literally from royal estate . William distributed or enfeoffed much of his land to his major barons, or tenants-in-chief , in return for them providing him with loyalty and an army when required. The barons subsequently enfeoffed some of their lands to lesser barons or mesne lords, who in turn may have distributed some of their lands and so on, a process known as subinfeudation .

The lords of the manor so-formed granted land to tenants within the manor in return for services and payments according to the customs of the manor . Most tenants were unfree and held land on a customary or copyhold basis, others were free tenants and held a freehold tenure. In addition there were leasehold tenures in some manors.

There were three types of manorial court originally: the Court Baron and Court Customary were responsible for the general administration of the manor, the upholding of the customs of the manor, the payments of fines and rents, the business of land and property transfer and disputes between tenants. In theory the Court Baron discussed freehold land and the Court Customary discussed customary or copyhold land but both courts were frequently held together as one, called the Court Baron, usually every three weeks. All tenants were obliged to attend. The responsibilities of the Court Baron decreased over time as the importance and responsibilities of the parochial system increased and by the late eighteenth century most of the Court Baron’s business was concerned with copyhold land.

Many manors were also granted the right to hold a Court Leet by royal charter or warrant, which tried and sentenced minor crimes and misdemeanours and was held approximately every six months, but often in combination with the Court Baron. The Court Leet originally heard the View of Frankpledge , a system whereby the community was divided into groups or tithings of ten to twelve households, including all male tenants over the age of twelve. All men were responsible for the good behaviour of the others and any offences were brought to the court and the offender named. The Court Leet gradually declined in importance and is not often found in the records after the seventeenth century.

The court rolls were so named because the minutes from each hearing of the court were originally recorded on parchment, sewn together and stored in a roll. In later years minute books were used. The court rolls a re perhaps the most common manorial records to survive. However, other very valuable sources of information are manorial surveys and maps. Manorial surveys included a description of the manor and its boundaries, its tenants, their tenure and rents and occasionally may include a map of the manor boundaries, particularly in the Interregnum period. There were three types of survey: extents were valuations of the lands, buildings, rents and duties of the tenants, often including a list of tenants, sometimes only including part of the manor such as the lord’s demesne (the lands of the manor occupied by the lord). A custumal listed the tenants with the customs by which they held their property. A terrier was a plot by plot description of the manorial lands and tended not to include tenants names.

Relief rolls were separate documents detailing one tenant surrendering a property and another being admitted. There may also be admissions books and / or Heriot books , the heriot being the payment due to the lord of a manor when a tenant died. These tended to be replaced by rent rolls as labourer services were replaced by payment of rent for property. Accounts were ledgers of tenant’s names and rents. Estreat rolls were separate lists of the amercements imposed for non-attendance at court and other offences. An essoin book was essentially an attendance book for the court.

Not all manorial documents are held at the relevant county archives. The Manorial Documents Register (MDR) is an index of all known manorial documents that is now maintained by The National Archives on behalf of the Master of the Rolls .

Accessing the Manorial Documents Register (MDR) (EDITED 6th October 2024)

The MDR for all counties in England and Wales may now be searched online. by parish name or name of manor: The Manorial Documents Register .

Searching on a parish name will reveal the names of the manors for which documents survive within that parish. Drilling down further provides a list of documents and where they are currently held.

The Blood Swept Lands and Seas of Red

Fri, 26 Sep 2014 14:44:10 GMT

In my last post I wrote about the military career of my great x 2 uncle, Cyril Frank Cowling.

Many of you will have seen pictures of the poppies being installed at The Tower of London in commemoration of the 100 year anniversary of the First World War, the Blood Swept Lands and Seas of Red . There is more in this video: https://www.youtube.com/watch?v=-VZPoyTiJJc

Until 10th November the Last Post will be played at the Tower of London at sunset each day and the names of a number of those in the Commonwealth forces who were killed in the First World War read out during the ceremony. I have dedicated a poppy to Cyril Frank Cowling already and last month nominated his name to be included in one of the ceremonies. I was not able to get to London on 2nd September but was lucky enough to be able to visit the poppies at the Tower of London the next day:

Other ways of Remembering

If you do still want to commemorate someone who died in the First World War in this centenary year there are a number of options in addition to those mentioned above. The British Legion have their own Every Man Remembered campaign in association with the CWGC.

Local Projects

Locally there were lots of initiatives timed to coincide with the centenary, notably a number of projects conducting research on the individuals named on local memorials. If you have a relative who was killed in the First World War carry out an internet search for projects in the town or village in which he resided at the time of his death. There may well be more information about your relative. Cyril Cowling is remembered both in Sawston, Cambridgeshire where he was born and in Cambridge where he lived when he enlisted.

A couple of examples of excellent publications arising from recent local projects, written and contributed to by colleagues of mine are:

Simon Last & Michael Good’s Aldeburgh War Memorial – the Men Behind the Names 1914-1918 :

and Barlborough Heroes , a Heritage Lottery funded project:

Remembering Cyril Frank Cowling (1892-1916)

Mon, 04 Aug 2014 12:18:13 GMT

As today is the 100th anniversary of the start of the First World War it seems an appropriate time to remember my great x2 uncle on my paternal grandmother’s side: Cyril Frank Cowling.

Cyril was born on 18th March 1892 in Sawston, Cambridgeshire, the son of John Cowling, a printer’s compositor, and Agnes Mary Cowling formerly Cornwell. Cyril is recorded in the Cowling family Bible as having died at “High Wood”, France in 1916.

At the time of the 1911 census, Cyril was single, working as a clerical assistant at a postal engineering branch and living in Birmingham.

Service records for Cyril Frank Cowling have not survived but it has been possible to piece together information regarding Cyril’s military career using a number of documentary sources including the records of the CWGC, military memorials, Soldiers died in the Great War 1914-1919, GRO death records, medal records, WFA pension records, soldiers’ wills, war diaries, published regimental histories and newspaper reports.

In fact, prior to joining the army, Cyril Frank Cowling had worked for the Civil Service in London, Birmingham and Cambridge. At the time of the outbreak of the First World War Cyril was working at the Post Office Engineering Office in Hills Road, Cambridge. He enlisted in London with the 15th Prince of Wales Own Civil Service Rifles with a group of friends, during or shortly after June 1915, as Private 4110 in the 1/15th battalion.

When Cyril enlisted he would have gone to Hazeley Down near Winchester for thirteen weeks training before being liable for overseas service. At some point Cyril was stationed at Chelsea Barracks and, whilst there, became a Signalling Instructor. When he returned to Winchester he discovered that his friends had been drafted to France and Cyril put in a request to also be sent to France. On arrival in France Cyril would have undergone final training at a divisional base before going “up the line”.

The 1/15th Battalion spent the first part of September 1916 on training at Franvillers, France and suffered no casualties between the 1st and the 14th September 1916. At 6pm on 14th September 1916 the 1/15th Battalion relieved two companies of the 21st London Regiment at High Wood. On the same day Cyril, mindful of the fact that his battalion were going to the frontline, wrote a brief will in which he left all of his possessions to his mother, Agnes Mary Cowling.

On 15th September 1916 the Battalion took part in the “Battle of Flers-Courcelette”, a general attack by the IV Army on High Wood. By 11am the IV Army were in possession of the whole of High Wood and Switch Line. However, at 6pm the 21st London Regiment were attacked from High Wood and were “practically annihilated by artillery and machine gun fire”. The severe losses observed at High Wood have been attributed in part to the fact that the battle was the first use of British tanks and the tanks were unable to move forward as intended due to the terrain and conditions.

At some point during the 15th September Cyril was with others in a captured German trench and was sending a message to the rear when he was hit in the neck by shrapnel. An artery was severed and the wound proved fatal. He left behind a girlfriend, a Miss N. Parker of Birmingham.

Cyril was awarded the British War and Victory medals for his active service. He has no known grave but is remembered at the Thiepval Memorial, also known as the Memorial to the Missing of the Somme on pier 13, face C. The information recorded in the Commonwealth War Graves Commission (CWGC)’s Register of War Dead is as follows:

Cyril’s name is also included on the war memorial in Sawston, Cambridgeshire and on the memorials within St Mary’s Church, Sawston and St Paul’s Church, Cambridge.

Cyril’s mother died shortly after his death but a dependents’ war pension was claimed for a time by his father, John Cowling. Cyril’s death was recorded in the local Cambridge newspapers, from which the following photograph was taken:

Starting Family History: Census Records of England and Wales 1841-1921

Wed, 26 Feb 2014 13:50:33 GMT

Originally posted 26th February 2014 and updated 30th September 2024.

This forms the third part of my beginner’s guides for those just starting out with their family history research in England and Wales. Part 1 looked at the General Register or GRO indexes of birth, marriage and death , Part 2 considered birth, marriage and death certificates in detail.

A census of the population has been taken every ten years since 1801, with the exception of 1941, the most recent having been taken in 2021. The census records are used alongside birth, marriage and death certificates to create the family tree, providing information as to an ancestor’s birthplace, place of residence, an idea of the social conditions in which an ancestor lived and information regarding other family members.

The early censuses contain little information of interest to the family historian, as there was no requirement to record information specific to individuals. Whilst some questions were asked regarding the number of people employed in a particular trade and the age ranges of the household occupants, names of individuals were not, for the main part, recorded.

The 1841 census was the first census to record names of individuals and was also the first census to be administered by the (then recently created) General Register Office. It was not without problems. There were errors caused by householders not understanding what information to include and some young children were omitted. There was significant mistrust as to what the information was to be used for, specifically people feared additional taxation, and some gave false information.

For the 1851 census more information was made available in the period before the census concerning the correct completion of the schedules. However, more questions were asked than for the 1841 census so there were still errors and omissions caused by lack of understanding. In general terms the number of questions asked and level of information collected increased as the census continued . The 1911 census reflected increasing concerns regarding the nation’s health and infant mortality. In addition to the type of information provided by the earlier censuses, the 1911 census also provides information as to the length of time a couple had been married, how many children they had had and how many were still alive . The 1921 census, the most recent census currently available to the public, looked at things slightly differently. No information was included about the length of a marriage and only the number of children under 16 years was collected. Now, though, there was information regarding whether parents were still alive (which can help point to a second marriage). There is also more information about ages in the 1921 census, being recorded in years and months not just years.

The enumerator collected the schedules the morning after census night. If the schedule was incomplete he was supposed to ask additional questions and complete the missing information. There will have been occasions where the enumerator completed the information based on his own knowledge or assumptions and introduced his own errors. If the householder had been unable to complete the schedule e.g. for reasons of illiteracy or illness, the enumerator completed it on their behalf. The information recorded in these cases is therefore written how the enumerator thought a name or place should be spelt. When all the household returns had been collected they were copied by the enumerator into an enumerator schedule or summary book.

The original householder schedules for the 1841-1901 censuses have since been destroyed . All that is available are the pages of the enumerator books that contain copied entries of all the householder schedules in the enumeration district. It is likely that some transcription errors will have been introduced at this stage, some families missed and some even entered twice. The original household schedules are available for the 1911 and 1921 censuses . The original enumerators’ books for the England and Wales 1841-1901 censuses and the original householders’ schedules for the 1911 and 1921 censuses are held by The National Archives. These have been digitised and indexed and are available on websites such as FreeCEN , Ancestry and Find My Past . At the time of writing the 1921 census was only available in Find My Past.

It should be noted that the online indexes contain transcription errors, resulting from the volunteer creating the index misreading the original image. In some cases this is due to the quality of the handwriting, in some the quality of the image used to produce the index. The censuses were not taken solely for the purposes of family history research ; as the individual pages were categorised and processed a number of annotations were made and lines were crossed through the text. This can make some images very difficult to read. In other cases the errors may be attributed to the inexperience of the volunteers in reading the style of handwriting typical at the time of the particular census. If a family is not immediately found, it is usually possible to find them using a variety of “lateral thinking” methods as to how their name may have been misspelt on the transcription. Alternatively the census records for the address at which they were last known can be fruitful as can trying the same search on another website.

An important point to note when searching the 1841 census is the instructions regarding ages . Adult ages were supposed to be rounded down to the nearest five years (not all were) with exact ages being recorded for those under 15 years. A wider range of birth years should therefore be employed when searching the 1841 census than the later censuses.

The administration of the censuses was organised by the registration districts and sub-districts defined for the registration of births, marriages and deaths. Each sub-district was further broken down into enumeration districts. When the enumerators books had been completed they were organised into “pieces”. For the 1851-1901 censuses, a piece is a bound volume containing a number of enumerator books. As each enumerator book will have contained the same page numbers e.g. 1-10, the bound volumes were then stamped on the right hand (recto) pages with an individual reference or “folio” number. One folio number refers to the numbered page and its reverse (versa). Each page of the enumerator book thus has a unique reference of the form:

RG9 / 1206 / 85

Call number (applied to the whole census) / piece number / folio number

The dates of the censuses and their associated call numbers are shown in the table below.

Starting Family History: Birth, Marriage and Death Certificates

Sat, 01 Feb 2014 13:20:34 GMT

This forms Part 2 of my beginner’s guides for those just starting out with their family history research in England and Wales. Part 1 looked at the General Register or GRO indexes of birth, marriage and death in detail. Next time we will look at census records .

On 1st July 1837 legislation took effect that ordered the registration of births, marriages and deaths. Certified copies of these entries from the registers form birth, marriage and death “certificates”.

When embarking on a journey into the history of your family the most fundamental building blocks from 1837 onwards are birth, marriage and death certificates. These provide evidence as to the places of birth, marriage and death of your ancestors but also provide a variety of information about where they lived, other family members and how they earned a livelihood.

The detail of the information contained in each type of certificate has changed over the years but is considered in general terms below:

Birth certificates

Date of birth

– If a time is provided this is usually an indication of a multiple live birth.

Place of birth

– Before c.1880 it was common for just a village name to be entered. Later entries tend to have more detail.

Forenames

– Some children were registered as simply “male” or “female”. This may have been because the parents had not yet decided on a name, the baby was to be given up for adoption or the baby died shortly after birth.

Sex
Father’s name

– Illegitimacy: Between 1837 and 1850 there was some confusion as to whether the name of the father of an illegitimate child should be included and so sometimes it was sometimes it was not. From 1851 to 1874 the father’s name and occupation should not have been recorded if the child was illegitimate. Following the Registration Act of 1875 and up to 1953 the father’s details could only be included if both parents signed as informants .

Mother’s name including maiden surname

– An entry such as “Mary Smith late Jones formerly Johnson” indicates that the mother’s maiden name was Johnson and that she married a Mr Jones before Mr Smith.

Father’s occupation
Signature, description and residence of the informant
Date of registration

– Births were required to be registered within 42 days of the birth, thus a birth on the 2nd December may not have been registered until January of the following year. There are exceptions to this requiring authorisation of the Superintendent Registrar or Registrar General.

Marriage certificates

Date of marriage

– Note that there is no separate column for date of registration as marriages were registered as they occurred.

Names of bride and groom

– These are the names at the time of marriage and may not necessarily be the name given at birth. Some certificates will include wording such as “otherwise known as” but not all.

Age of bride and groom at date of marriage

– In 1837 the legal ages of marriage were 12 years for a girl and 14 years for a boy, with parental consent required for those under age 21 years.

– From 1929 the legal age of marriage was changed to 16 years for either gender with parental consent still required for those under age 21 years.

– From 1969 the legal age of marriage remained 16 years for either gender but parental consent was only required for those under age 18 years.

– “Full age” indicates someone to be age 21 or over.

Marital status of bride and groom
Occupation of bride and groom
Residence at the time of marriage of bride and groom
Name and occupation of the fathers of the bride and groom
Names of witnesses

Death certificates

Date and place of death

– As with birth certificates the level of detail increased with time. Note that someone could die some distance from home and that place of death does not indicate place of residence.

– As this was provided by the informant it was not always accurate.

Occupation

– For wives, widows and children the occupations was usually given as “wife / widow / son / daughter of ….”

Cause of death
Name and surname of deceased
Informant’s details

– From 1875 the informant’s details included the relationship to the deceased and their qualification to be an informant, e.g. present at the death.

Date of registration

– Deaths were generally required to be registered within 5 days, though longer periods were allowed where a post-mortem and / or inquest was carried out.

Many believe that the internet sites provide access to images of the birth, marriage and death registers. Unfortunately this is not the case: What can be searched are the national or General Register Office (GRO) indexes of births, marriages and deaths for each year (see previous blog post). Once a GRO reference has been found a copy of the certificate may be ordered from the General Register Office via: https://www.gro.gov.uk/gro/content/ or phoning 0300 123 1837. Copies are available elsewhere but tend to be more expensive than the fees charged by the GRO. An alternative source of information is to obtain the certificate from the local Superintendent Registrar.

Starting Family History: General Register Office (GRO) indexes of Birth, Marriage and Death

Wed, 08 Jan 2014 13:18:36 GMT

As we have just entered 2014 I thought I would start the year with some beginner’s guides for those just starting out with their family history research in England and Wales. Part 1 looks at the General Register or GRO indexes of birth, marriage and death in detail. Next month’s blog will consider birth, marriage and death certificates .

Civil registration was introduced in England and Wales on 1st July 1837. The General Register Office (GRO) was set up in London and England and Wales was divided into just over 600 “registration districts” for ease of administration, each district under the supervision of a “Superintendent Registrar”.

Birth and death registers were completed at the time of registration by a local Registrar. Marriage registers were completed at the time of marriage by a clergyman (Church of England marriages), local Registrar (most nonconformist and all registry office marriages) or nonconformist minister (some nonconformist marriages after 1898). At the end of each quarter (March, June, September, December) the local Registrar (or clergyman) was required to copy out the births, marriages and deaths that had taken place in his sub-district during the preceding three months and send them to the district Superintendent Registrar. The Superintendent Registrar, in turn, forwarded the copies to the Registrar General.

Once the quarterly returns had been received by the GRO they were grouped according to locality and bound into “volumes”. Originally returns were ordered alphabetically by registration district within a volume but in 1852 the volume organisation was changed such that the districts were ordered by proximity to neighbouring registration districts. To form the “GRO index” the details of each birth, marriage and death from all 600+ districts were copied again noting the volume number and page number formed within the volume by that page of returns. After this process had been completed for all returns from all districts the individual entries were sorted into alphabetical order before being copied again to form the GRO indexes for that quarter. Until 1984 this process was repeated four times a year and a separate index exists for each quarter e.g. the index for March 1878 includes all the entries for Jan, Feb and Mar 1878. From 1984 onwards the GRO index was compiled annually. A GRO index reference thus consists of five parts: the individual’s name, the year and quarter of registration (month from 1984 onwards) , the registration district, the volume number and the page number.

As is seen above, there were a number of copying stages involved in the creation of the GRO indexes and, inevitably, there were some transcription errors. Some names were misread on the register copies, some missed completely, some indexed under an incorrect district. All of these factors need to be considered when conducting a search of the index. Not finding e.g. a marriage in the GRO index does not mean that it did not occur.

The GRO indexes of births, marriages and deaths are the records that the family historian may search on websites such as FreeBMD , Ancestry and Findmypast . Unfortunately the indexes do not include all of the information from the birth, marriage and death certificates. The only way to establish whether the correct reference has been found is usually to order the certificate. The information included in the GRO indexes up to 1984 is summarised below:

Birth indexes

Sep 1837 – Dec 1865:

Surname, all forenames in full, registration district, volume, page number

Mar 1866 – Dec 1866:

Surname, first forename in full and initials of others, registration district, volume, page number

Mar 1867 – Jun 1910:

Surname, first two forenames in full and initials of others, registration district, volume, page number

Sep 1910 – Jun 1911:

Surname, first forename in full and initials of others, registration district, volume, page number

Sep 1911 – Dec 1965:

Surname, first forename in full and initials of others, registration district, volume, page number plus addition of mother’s maiden surname

Mar 1966 – Dec 1983:

Surname, first two forenames in full and initials of others, registration district, volume, page number, mother’s maiden surname

Marriage indexes

Sep 1837 – Dec 1865:

Surname, all forenames in full, registration district, volume, page number

Mar 1866 – Dec 1866:

Surname, first forename in full and initials of others, registration district, volume, page number

Mar 1867 – Dec 1911:

Surname, first two forenames in full and initials of others, registration district, volume, page number

Mar 1912 – Dec 1983:

Surname, first two forenames in full and initials of others, registration district, volume, page number plus addition of spouse surname

Death indexes

Sep 1837 – Dec 1865:

Surname, all forenames in full, registration district, volume, page number

Mar 1866 – Dec 1866:

Surname, first forename in full and initials of others, registration district, volume, page number plus addition of age of the deceased

Mar 1867 – Jun 1910:

Surname, first two forenames in full and initials of others, registration district, volume, page number, age of the deceased

Sep 1910 – Mar 1969:

Surname, first forename in full and initials of others, registration district, volume, page number, age of the deceased

Jun 1969 – Dec 1983:

Surname, first two forenames in full and initials of others, registration district, volume, page number, date of birth replaces age of the deceased

The most important dates to note are the inclusion of mother’s maiden surname on birth indexes from September 1911, the inclusion of spouse’s surname on marriage indexes from March 1912, the addition of age at death to the death indexes from March 1866 and the addition of date of birth to the death indexes from June 1969.

UPDATE: In 2016 the GRO published its own indexes to birth and death. You can read more here.

Reflections on 2013

Mon, 30 Dec 2013 16:23:42 GMT

I do hope that you have all had a lovely Christmas break with your families. I have been lucky enough to have my family to us this year. Christmas is always a little bittersweet, celebrating with those that are here whilst thinking of those now absent. There is, however, little time for melancholy in our house with an incredibly excited six year-old counting down “How many sleeps?”

As we approach the end of the year I always find myself reflecting upon the year just coming to an end. In July of this year I was proud to be awarded the IHGS (Institute of Heraldic and Genealogical Studies) Higher Certificate in Genealogy. There are a number of routes to this qualification but for me it followed three years of intensive learning and assignment writing with the constant support of my fabulous tutor, Les Mitchinson. I was immensely pleased to be given the added award of a Distinction especially when I discovered that myself and fellow genealogist, Julia Henderson, were only the third and fourth individuals to have ever achieved this.

November marked my third year of trading as Professional Family History. Over this time I have had some wonderful clients. Some have been with me since the beginning, some I have only met recently. We have had some frustrations during research this year but also some wonderful successes.

It is not appropriate here to mention all the cases worked on this year but as a couple of examples: A report to one of my longest standing clients triggered a long-forgotten memory of a family story in her elderly mother, from many years ago, and this has confirmed the particular research area to target next.

One of my favourite research moments was a “brick wall buster”. I have a lovely client who came to me with many years research and a “hunch” as to where earlier ancestors originated. I’m sure we all have moments like this in our own research during our continued search for missing information: “I have possibilities A, B and C but I have a strong feeling it must be C”. I am simplifying things here, there was some supporting information in favour of C but no EVIDENCE. As professionals we must counsel against such feelings and advocate thorough research to prove or disprove theories. My client and I have been on a journey looking at records for two parishes in Suffolk some distance apart. Towards the later part of the year I found the document confirming that the individual who had been living in parish B was born in parish A. There is more to consider but it was a wonderful breakthrough.

There have also been some interesting sources used this year. One I must mention as it is so often overlooked are the records of Freemen. One of my clients has ancestors who were admitted as Freemen to the Borough of Sudbury. Freeman records are often overlooked as “unlikely to contain my relative” but when they do they can provide a host of information.

In general terms there were four means of being admitted as a Freeman to a borough or guild: servitude, via apprenticeship, patrimony, by being the son of a freeman, redemption, by purchase, and honour, granted on an honorary basis.

An example of an entry in the admission registers is “…Samuel Godfrey of London Baker son of Thomas Godfrey late of the said Borough Butcher deceased is a freeman of the said Borough and Hath the right to vote for members to serve in Parliament for this Borough…. [07 March 1733]”. It is readily observed how the one entry provides information on family relationships, occupations and places of residence and, in this case, provides a date by which the father had died.

As I look forward to 2014 it is with some excitement. I have research planned over the first few months, some on continued cases, some with new clients. I also have a few professional “firsts” in the pipeline that I am very much looking forward to.

To close, I wish you all a Happy New Year and hope that 2014 brings you everything you wish for.

Killing off Your Ancestors

Sun, 27 Oct 2013 18:01:53 GMT

I recently blogged about Monumental Inscriptions as an underused source of information for genealogists. There are other intrinsically linked records relating to the deaths of our ancestors that are also often overlooked, even the death certificates themselves. Many of us conducting our own research leave death certificates as a luxury item to buy at a later date. Indeed if you search for a “professional” genealogist offering family tree “packages” many consider death certificates an add on item, not included as standard.

I have to say that I find this immensely frustrating. More than once I have solved a problem using the informant details on a death certificate. Personally I always include a death certificate where possible when compiling a client’s family tree.

This is why I was so interested in Celia Heritage’s book, Tracing Your Ancestors Through Death Records . Yesterday I had the opportunity for some “reading for pleasure” and I have to say I was so engrossed that I read the whole book from cover to cover in one day.

Celia’s writing style is very easy to read. She talks about the major record groups but introduces examples from her own research to bring the records to life. Death certificates are covered in detail as are burial records, death duty records, coroner’s inquests, newspapers, wills and other probate records and, of course, monumental inscriptions.

There are many genealogy books on the market that take you through the various records, often separating beginners’ records from more advanced research. There are two main differences in Celia’s style to many of these works. Firstly the records are put into social context. What did this mean to the rest of the family? Did others in the village die from the same disease indicating an epidemic of some kind? Secondly there are many hints for good quality sound research. Not only will you learn about what you may find in different record sources that can add to the breadth of information you have for your ancestors; you will also learn why your ancestors may not be found, where record survival is patchy and what alternative searches to try.

The research techniques employed and advice presented relate to any genealogical research and are not limited to death records. Furthermore, in her fabulously detailed chapters on death certificates and burial records there is much to be learned that can be applied to birth and marriage certificates and parish registers in general.

This is a book that provides essential reading for both the beginner to family history and the more experienced researcher who is, perhaps, looking for some alternative strategies to solve research problems.

If you take one message, please reconsider the thought that death certificates are not required and kill off those ancestors!

First Visit to The National Archives

Tue, 24 Sep 2013 13:45:23 GMT

This month I had the opportunity to make my first visit to The National Archives UK. I have visited many local archives over the course of my own research and professional work but had not yet made a visit to Kew.

I had actually become quite nervous about visiting. It is so much larger than any other archive I had visited. There are three different floors – how would I be able to find anything? I had heard tales of it being likely to take my half my day to obtained the treasured Reader’s Ticket. As it turned out, I had a fabulous day, everything was very straightforward and the staff were exceedingly friendly.

Plan ahead…

The most important piece of advice I can give to anyone about to visit The National Archives (TNA) is to plan ahead. There is plenty of advice on TNA’s website if you spare a few moments to look around. Find out about the information you are searching for. Is there a Research Guide available for the type of research you are conducting? Are the documents available online? Are the documents on microfilm at TNA or will you have to order original documents? Pharos Tutors run a course on using TNA’s catalogue, that can be undertaken remotely: The National Archives Website and Catalogue – Finding People. I am sure there must be other courses available and there are also some Video Guides available on TNA’s website.

Travel woes…

The National Archives is based in Kew, London close to the Kew Retail Park. A detailed map of the area may be found on The National Archives (TNA) website in the Where to Find Us section. It is readily accessible by train but I tend to avoid travelling through central London unless absolutely necessary so I drove. According to Google Maps the journey from Suffolk should have taken me an hour and three quarters but traffic was heavy around Heathrow Airport that morning and it took me nearly three and a half hours to get there. It is fairly easy to find even though the sign for the last turn off into Bessant Drive is somewhat understated. The extended journey time meant I did not arrive until just after 10am but there were still plenty of spaces available in the (free) car park.

Arrival…

On arrival my route from the car park took me around the lovely lake area, complete with swans and fountains, up to the main entrance (shown above). The size of the building hit me as soon as I walked in through the main entrance but, even though there is a welcome desk, the way to the lockers where you need to leave most of your belongings is well-signposted.

Archives vary on their exact policy of what is allowed into document rooms and what is not from a conservation point of view. Mobile phones, laptops and cameras are allowed in, so long as they are in silent mode. Bags, coats and any food items must be left in lockers and pens are most definitely not allowed. The point on which I was caught out is that you are not allowed to take in pencils with an eraser at the top at TNA.

Remember your identification…

If you want to look at original documents you need to obtain a Reader’s Ticket. When I arrived I was not sure whether I would be looking at microfilm or original documents. I decided my best strategy was to head straight for my Reader’s Ticket “just in case”. This was so much easier than I expected. The stairs and lift are both very close to the locker room and I went straight up to the second floor where a fairly small room was labelled “Reader Registration”. On entering, I simply sat at an available computer and filled in my details. At this point you need to enter the type of identification you have brought with you so make sure you have read the guidelines and have brought the correct documentation. When I had entered my details there was short video to watch, around five minutes, describing correct document handling. I then joined a queue to have my Reader’s Ticket issued where I presented my documentation and had my photograph taken. All in all I had my Reader’s Ticket in my hand about thirty minutes after getting out of my car. I did visit during the week and I imagine a longer wait would be expected on a Saturday.

Start here…

My Reader’s Ticket in hand I was advised to head to the first floor to the “Start Here” area. As I had printed out the details of the documents I wanted to consider I only needed to check that none were available on microfilm and find out how to order documents. Next to the “Start Here” desk are a number of computers each with an attached card reader. A simple swipe of my Reader’s Ticket logged me in. Before ordering any documents I was required to book my seat in the Document Reading Room. If you have not been before or have no preference a seat is selected for you based on whether you will want to use a camera (by the window) or are with a group of associates (not the quiet area). I then proceeded to order my first three documents by reference. It is also possible to search for documents if you have not come with references in hand before ordering. You are allowed to order up to three documents at a time but, once they have been issued, can order more.

Waiting for documents…

My document took around twenty minutes to arrive once I had placed my order. There are screens in the Research and Enquiries room that purportedly tell you when documents are ready. I may not have waited long enough for the detail to scroll through but I never saw any names listed. I found the easiest way to find out if documents were ready was to log in again and check order status.

Finding your documents…

Once my documents were ready I headed to security for the Document Reading Room and used my Reader’s Ticket to swipe entrance to the room. There I found rows of brightly coloured lockers, each labelled with the seat numbers allocated at the start of the ordering process. It was fairly simple to find documents and my seat and begin researching in earnest. The use of my camera to take photographs of documents was free. One document I ordered before my lunch was still not available on my return. A quick look at the order status showed it be an oversized item, available on the second floor in the Map and Large Document Reading room. Again, it was a straightforward process to access material upstairs.

Overall, my day at The National Archives was a wholly pleasant experience. The staff were very friendly and happy to answer questions. There were some waits for documents but there was so much published material in the Research and Enquiries Room that I found the time flew by.

There is also a lovely coffee shop in which to grab some lunch and of course the bookshop, which is always a personal weakness…

The Hopkins of Yardley

Thu, 08 Aug 2013 17:05:48 GMT

On a wet day at the end of July 2013 we visited my former ancestral home of Yardley, once in Worcestershire, then in Warwickshire, now firmly placed within the suburbs of Birmingham. My research to date indicates that my great x 3 grandfather, Joseph Hopkins, was baptised in Yardley in 1817, the son of Thomas, a farmer, and Sarah Hopkins.

I was born in Sutton Coldfield, near Birmingham, have now lived in Suffolk for many years. When I visit villages in Suffolk, Essex and Cambridgeshire much looks unchanged and the character of the original villages, for the main part, remains the same. Birmingham, in contrast, is an ever expanding beast. Long after the industrial revolution and the back-to-back house living it continues to grow and absorb the surrounding area, so much so that much of Yardley looks as though it is part of the city now. There does, however, remain a beautiful Conservation Area which includes the old Trust School, next to the parish church of St Edburgha.

Yardley is one of those parish churches for which the graveyard can be a real disappointment to the family historian: the gravestones were removed in 1959. Thankfully a record was made of the monumental inscriptions and the position of each grave in the graveyard and I found the lady at the Parish Office very helpful when I made enquiries a few years ago. I have found at least an entry for my great x 4 grandmother, Sarah Hopkins, who is buried not far from the tree in the centre of the picture below.

Whilst in Yardley we also managed a visit to the fabulous Blakesley Hall. The pictures here do not do it justice, but more images may be found on their Website.

Blakesley Hall was built by the Smalbroke family in 1590 and was passed down the family until it was sold in 1899. From 1768-1849 it was home to tenant farmers, the Hopkins, and I was delighted to find them mentioned in the entrance hall exhibit and guidebook.

The Power of Monumental Inscriptions

Sun, 28 Jul 2013 17:25:00 GMT

Monumental inscriptions are a terribly underused source of family history information. We manage to find a death, maybe even a burial for our ancestor and then we move on to the next person on our list. The search for the grave and any surviving monument and inscription is firmly assigned to the “do sometime in the future” pile.

I paid a brief visit to the parish church of Lofthouse, Yorkshire on a weekend away. My Jenkins ancestors, my maternal grandfather’s line, were coal miners for many years. Originally from Flintshire in North Wales, they moved to the Lofthouse area in the mid 1800s and continued as coal miners for a further four generations.

My ambition on arrival at the graveyard was to locate the resting place of my great x 3 grandparents, John Jenkins and Sarah Jenkins née Foulks. Armed with camera, notebook, husband and daughter we began to search the graveyard stone by stone for any reference to the Jenkins family.

John and Sarah’s grave is shown below.

The inscription reads:

“Of Sarah

The Beloved

Wife of

John Jenkins

of Rothwell Haigh

Who Died December 8th

1874 aged 52 years

Our home is not this

mortal clime

Our life knows not its bounds…..

And death is but the line that lies

Between the soul and Paradise.

Also Sarah Jane daughter of the

above who died October 25th 1856

aged 4 months

Also of Francis son of the

above who died August 28th 1863,

aged 1 year and 4 months

The Lord gave and the Lord taketh

away Blessed be the name of the

Lord

Also of John Jenkins,

who died April 26th 1891

Aged 68 years”

and it is seen that two children who died in infancy are also remembered here. What is most useful about the information on the inscription is that Sarah Jane and Francis were both born and buried between census returns. As it happens the parish registers for West Yorkshire are now available and indexed online but at the time two new members of the Jenkins family were found on this gravestone that would not have been discovered until local research had been conducted.

An even more remarkable find was yet to come. A second Jenkins grave was found only a few feet from John and Sarah.

The inscription reads:

“In Loving Memory of

Seven Children

of Sam and Ann Jenkins

of Australia, late of Lofthouse

Sarah Elizabeth, died May 1st 1872

Aged 15 months

Ada, died December 17th 1873

Aged 9 months

Sarah, died October 9th 1882

Aged 7 years

Martha Ellen, died Oct 10th 1882

Aged 8 years

Anne, died November 5th 1882

Aged 5 years

Wilfred died November 10th 1883

Aged 3 months

Minnie died at sea May 24th 1884

Aged 9 months

Not Dead but Sleepeth

Also of Richard Humphrey Jenkins

Son of the Above

Died April 30th 1910

Aged 28 years

N. S. W. Australia”

It is not clear which family members are interred in this grave and further research is warranted at a later date. Sam Jenkins was John and Sarah Jenkins’ son. Sam, also a coal miner, had married Ann Watson in the neighboring parish of Rothwell in 1870. At the time of the 1881 census they had four children. They had not been found in the 1891 census but it was known that three of their children had died in 1882.

This inscription reveals that the family emigrated to Australia. It also provides information regarding more children and the fact that one child died “at sea” provides a clue as to the year of emigration to Australia. Sadly, of Sam and Ann’s nine children, only two survived to reach Australia.

These are only two examples of the type of information that may be obtained from monumental inscriptions.

Sadly, many graveyards are now being cleared for development or “ease of maintenance” and the gravestones are being lost. The inscriptions also deteriorate with time and it is only thanks to the efforts of volunteers, such as the family history societies, that records of these inscriptions are being preserved.

I urge you not to overlook this incredibly rich source of family history information, you never know what you may find…